TTHERM_01035700

Length: 141 bp

cDNA Sequence

ATGGGATTACCAATTAGAAATATCCAATTCGCTAGATATCACTATTTAGCTGCAGTTACCGTTTTCACTTACTTTGCTACTCGTTGCTGCTTATTAGATTACAAGAAGTACTATCCTTTAGCTTCAGTCAAGAAGATTTGA