TTHERM_01049200

Length: 1821 bp

cDNA Sequence

ATGGGCATTGGTTAAAAGGGTGGAGACTTAGCATTGTAGGTAGGAGAAGGATATGGTGGGGGAAAGGCTGAATATTAACACATAGCTGAAAAATAAGTATTTGAAGTGACGAACTAATAATAATACATCAAAAAAAACTTTTCAAAAGGCAAATATAGTTTAAAAGATCATTAGATAAAACAAATAAGAAACAAATTCATCTCTCAATAAGATAGTAAGTAGCTCAGAAAAAAAATGCTTTCCAAGATTTTAAGTTCCAGATTACCTGCTAACTCCTTAGTTAGTATGTACAACCCTTCCTTCAGCTCTGTTGCTGGTGAACCCAAGTTCTTAGAAATGGTCCACCAATACTTCGATGCTGCTGCCTCATACACCAGAATCTCTCCTGATAAACTTAACTACTACAAGAAGGCCGACTGTGTTATCAAGTTTACCATTCCCCTCGTTAGAGATGATGGTACTATTGAATCCATTGAAGCCTACAGAGCTTAACACAAGTTACACAGACTTCCTACTAAGGGTGGTACCAGATATGCTAAAGACATCAACATTCAAGAAGTTGAAGCCTTGTCCTGTTTGATGACTTTAAAGTGTGCTGTCGTTAACTTGCCTTACGGTGGTGCTAAGGGTGGTATTGGTTTCAACCCCAAGTAATACTCTGCTAGAGAAATCGAATCTCTCACCAGAAGATACACTCTTGAATTAGCTAAGAAGGGCTTCATCGGTGCTGCCATCGACGTTCCCGGACCTGATTTGGGTACTGGTGAAAGAGAAATGTCTTGGATGAAGGATACTTATCAAACTTAGAAGATCTATTTCTCTTAAAAAGATTAAATGATCTTCTCAAGACTTACATTTTATACTAAATTTTGTTATTATGAATAAAATAGTTTCTTCGGTCACAAGGATATCAATGCTCACGGTTGTGTCACTGGTAAGGCTCTTAACTAGGGTGGTATCAGAGGTAGAACTGAATCTACTGGTCTTGGTGTCTTCTATTGCACTAGAGATCTCCTTAACGACAAGCCTCTCATGGAAAAGTTCGGTGTTGAACCTGGCATGAAGGGCAAACGTTTCATCATCTAAGGTTTCGGTAATGTCGGTTACTGGGCTGCTAAGTTCATCACTGAATATGGTGGTATCGTTACTGGTATTGCTGAATGGGATGGTTCCATCTACAACTCTAAAGGTATTGATATTGAAGATCTCTACCAATATAAGTTGAACAAGAAGGGTATCAAGGGTTATCCTAGAGCTGAAGAAGCTTTCGATAACGAAGATGCCATCTACAAGGAATGTGATGTCTTCATTCCCGCTGCTTTTGAATAAACTGTTAACAAGAATAACGCTAACAGATTCAACTGTAAGGTCATTTCCGAAGCTGCTAATGGTCCTACTACCATCGCTGCTGAAGAAATCTTAACCAAGAAGGGTGTCGTTTTCTTCCCTGATATTTTAGTTAATGCTGGTGGTGTTACTGTATCTTACTTCGAATGGCTTAAGAACTTAGATCACATGAGACCTGGTAGACTTACTAGAAAGTGGGAAGAAAAGTCCAAGCTCAATCTCCTCCACGTCATTTCAGACATCACTGGTCTTAAGTTACACTAACTCGAAGAAAAGCACAAGAATCTCCTCAGAGGTGCCACTGATAAAGATATTGTCTACTCTGGTTTGGAAGAAGTTATGTCTGTTGCTGTCAAGGAAACCAAGGAAACTTGTCTCGAATTACACTGCTCTATGAGAATTGCTGTCTACGTTAATGCTATTAGAAAGATCCACTAACATTTCGAAGTTGCTGGTATGCCTCTTGCTAAGTGA