TTHERM_01050690

Length: 747 bp

cDNA Sequence

ATGTCAAGAAGATACGATTAGAAGACTACTACATTTACTAATGATGGTAAATTATTGTAAGTTTAATATGCTATTGAAGCTATTAACAAAACTGGCAGTGCTATTGGTATTTTAACAAAGGAAGGTATTGTTTTAACTACTGAGCGTTAGGACGTAAGCTCTCTTTTGGAAGCTCCTACTCATTCCGAAAAGATTTTCTAGTTAGATTCTCATTTGTACTCCGTTGTCAACGGTTTAACCGCTGATGCAAATTACTTGATCGACATTGCTAGAGTCGAAGCATAAAACTACAAATATCATTATGGTGGTGAAAATATCCCCATCGAATAGCTCATCGTTAAGATCTGCGATATTAAGTAATCTTATACTCAAATTGGAGGTTTGAGACCTTTCGGTGCAGCCTTCCTTTTCGCTGGTCACGACCGTCATTTAGGATATCAACTCTATTCTACTGATCCCTCTGGTAATTATTTCGGCTGGAAAGCTATCGCCATCGGTCAAAAGAATGCTGAAGCCAACGGTTTACTCAAGCCATCTTATAAAGTTGATATCACCCTTGAGGAAGGTATCAACTTAGGTATCAAGGCCCTTGTTAAAACTATGGATACCGCTAATCCCTCTCCTAAAAAGATTGAAATGGTTGTTATTAGCGAAAACAAAACCTCTAAAAAAATAGAAGGACGTACCCTCAAAGAAGCTGAAATCAGAGCTCTTTTAGAAAAAAATGGTTTCAATGCTGAAAAGTGA