TTHERM_01062900

Length: 507 bp

cDNA Sequence

ATGAAGGCTTTATTCGCTTTAGCTGTCTTATTAGTTACCGCTTCTTGCTAAGTTTACCCCATGAATGTGGGTAATGAATGCTCTACTGCTACTTGCTCTATAAGCTATTGGTAATACAATAATACCAATTTCAATTATACTTGCCCTGAGGCTGGAAAAAGTATGGCTAGATTCAGAATTGCTCAAGGAAACTACTTCTTAGATTTTGTTGCATATAATCCATTAACTTCTGACTCACCTGTTACTATTCCCCTCTTTTACAATCCTAATCCTAATTAAAGTGGTCTCTAATATTACTATTCTCTCTAATAAGGTCACAACTTTGTTATCTTGAATTGCACCCTTACTGCTGCTAAATAATTAACTAGCCTCTGCTCTAAGCACGCTTTAGTTGGTGGTAAGATTTACAAAGATGTTTTCCAAAATGCATGTGCCTTCGGTTTGGATGCTCCTAGATACGCTTTCTTACAATAAGAAATACCATTGGAATTCGAGTCTTCTATTTGA