TTHERM_01074550

Length: 1104 bp

cDNA Sequence

ATGAAATTAGCATAATTAATCCTATTCTCTTTATTGAGTTTAACCTGCTTTTGCTAGCTAACATCTCTAAAAAGTGAAAACAAGCTTGAAAATATCAAAGTTGATGATCTCATACTTTTTAATAAATGGAAATTTGAGAATAAAAAAAGCTATTTCAACCATGAAGAAGCTAGTTTTCGTCAGATATTATTTTTGAAAAACCTTAAAAATATAAACTTCCATAATGCTAACAAAACACATACTTACAAAGTAGCAGTCAACTAGTTCACAGATTTAACATAAGAAGAATTTGAAGCTAGCTATTTGAATCCTATTTTAACTTAGGCAGAGAAACTTAGATTCCTTCAAAGAGATGGCGGTTAAAACGGTGGTAAAGACGGTGGATCAAATTAAACTTAAAATTGTACTGATGTTAAAAACTGTTAAAATCCACCACCTCCAGTTATATAACCTCTATATAACGTTAGCTAAAGCATTGACTGGAGATAGTCAGGTGCTGTAAGTCCTGTAAAAAACTAAGGTTCTTGTGGTTCTTGTTGGGCTTTTTCAGCTGTTGCTTTGGCTGAAAGTGTAAACTTACTAAGGAATAATTCTCTAGCCTTGTATTCTGAATAGGAATTAGTTGATTGCACTTACAAGAATCCTTAATACTATAACTATGGTTGCTAAGGAGGATGGCCTAGTGTTGCTTATAGATACATAAAGGATTAAGGTATTTCTTCCCAATAAAATTATCCCTATATTGGCTAAAACAGAAACTGTTCAATTAACTCAGCTTCTCCTCCTAAAGCCTTTTATGCCAAAGATCCTATTTACTATTATACAAATAATGGAAACTAGACAAATTTAGTGTAGTATGCAGTTAATCAAGCTCCTATTTCTGTTCTTGTAGATGCAACTAATTGGAGCTCTTATTCTTAAGGAGTATTTAACAACTGTGGAAACGTAACTATAAATCATGCAGTTCTGCTTGTTGGATATGATACTTCTGGAAATTGGCTAGTCAAAAACTCTTGGGGTACTAACTGGGGTCAAAAAGGTTACATTACTCTAGCTCCTGGTAATACATGCAATGTATAAAGCTCACCATTAGGAGGTTTATGA