TTHERM_01079060

Length: 315 bp

cDNA Sequence

ATGAATCACGAACCTGAAGTGAAAGCTACTGATATGGAAGAAGATATGATTAAAAGAGTAAAAGAAATAGCTATTAATGCTGTTAAAGAATACAAACAAGAAAAATTGATGGATATGGATGGAACTGTATTGTAGGAAGAAATTTCGGATCTCATATCATTCACTAAACCAAAAAATATATTTTCTTTAAAATTAATGAATTGTGCTTATTACTCTGGAAGGCTTGAAGCTAACTCTAAGTCAAATTATATAATCAAATATATATATAATAATAACAATAACAATGTTTTGTATTCATATATAGTAATTATTTGA