TTHERM_01080490

Length: 174 bp

cDNA Sequence

ATGTTCAACTTTTTAAAACAATTCAACAAGAACCAACTCACTCAATTCACCAGATACGCCATGAGCTCTGGTAAGGGTAAAGGAGCCAAGCCTGCTGGTGAAAAGCCTGCCGCTGAAAAGCCTGCTGCAGCAGCTGATAAAAAGCCTGCTGGTGAAAAGCCCAAGAAGAAGTGA