TTHERM_01082940

Length: 1326 bp

cDNA Sequence

ATGTAGGGAGAAATAAACAGAGATGAAATAGAGGAATCTAAAGAAAATTAATCTAATTCATATTCCTAAAATTATTAATAATATGAAAAATTAAAAAGTTCATAAGTATAACAAGATGAAAATGACCAAAATTAATATGTTTAAAATAACCAATAATATGAAATCTAACAAAATTAAAATGATTAAAATAACCAAAATAATCCCTTATATGACTAACCATTTAAATTTGAAGTAAATCATAATATAGATAATGATTTATAAATGATTAAAGATTGGATAGGTCAATTTTCTAATTTAAAAGATGTTCAACAATAAAACGAAGCCAGTCATGATTTTATGCAAAATTTTGTGACATAATACCCTACCTCTGATTTATCATTACCAGATATTTCCTTTCATTTCAAACCTGATGGATCATAAGCTATCCTCTTTAGCATTTTCTGTTAACCTGAAATACTATAAAAGTGTGTAGCTAAAAGAAATGATATAGCGGAATTATTTTATGACTCAATAGGTTTCACTATACTTTTAGTTATTAAGCCTAAAATTGACTATAAGAATTTTGACTAAAAACATTAAGAATTTAATTCTAATGAGATACCTCTGGAGGTTTTTATTTCTAACAAGTTTGAGAGTTAATAAAAGATCTTATACAAAATAGGCTTGTAAGCAAAAAGGTAAATAAAGGTATTCCCTCAAATCTAAAATTTAAGACTTAGAAGAGATTTAAATGAATTGTTTGAGTGTTTAGATGATAAATTTGAATTTAACTATTCTAATTGCAGTGATCACTGTTTCGCTTACTACACTTAGTCAGATAATTTAAATTAGCTTGAAGGCTTGATCATAGGTCCACAAGACACTCCTTACGAAGGAATACCCTACACTGTTACTATTTAAATACCTGATTAATACCCTATTGAGCCTCCCAAAGTTACTTTCAACTAGTAAATTCTGCATCCAAACATCAGTGAATAAGGAGAAATATGTCTAAATATTCTCTAAGATAAATGGAGTACAGTGCTTACCATTTAAAAAGTGCTTGTAAGTATAGTCAGTTTACTTTATGAAAAGAATTTAGATGATGTTTATAATCACTATGCAAAAACCCTATATCAAGAAGATCCTGAAGAATACAAAACTTTAATTAAAAAATAATCCATATTGCAAGATAGCCAAAAGCTAAAAATTGACTTCAAATAATTGGCAAAAGTACCCATAAATGAATAAAATGGATATGATGAATATGAAAATAACGATGGCTATAATACTTATGAAGGATATGATGATGATGATTACTAATATATGGATATAGAAGATGAATGA