TTHERM_01093500

Length: 429 bp

cDNA Sequence

ATGGAAGGAGAAGGATTAAATGCCAAGGCTCTTAATGATGCTCTTATGAAAGAAGACGAGTGGGCCAAGGCTATCATTTTTGATCAAAATTTAAATATAATTACTCATAAAAACTGCCCTGCTTCAGTTGAAGAATTGAGACCTTATTTAACTGCATTTGACTCTCGTGATAATACCATCGGAGCAGGATTTGAATTATTAGGTGAACACTATGACGTTCATAGATTCCACCCTCCTCTTGTTTATGGCAGAAGAGGTGATGCTGATGTTGGTGAAGGTATCTCTCTTGCTAAAGGTTTCTCTAAGAAGGCAAACTCTAATATTTACTTGCTCATCACTTACGAATTACCAATCATCTCTGCTAGAGCTGTTCCCTAACAAATCAACTTCTTCAACAATCACATTGGAGAACTCGAACAAGCATAATGA