TTHERM_01099200

Length: 678 bp

cDNA Sequence

ATGGAAAGAGCTGATAGAAGATATAAATTTGAACACAATTGGGCTAAAGGATTTTGTTACTTTACTTTTGGAGAGTATTATAATCCCAGAAAAATGGGAGTAGGTAGAATTAAAGCTGTCAATGAATATTAATTGAATCCATAAGAAGAATTTGGAAAAAATATTTTGCACAAAAACTTTGATATTGTTACTCTTGTTATGAATGGTAGTCTTAGACATAATTCTTCAGTAAAAGAAAGAGTACCAATCGAAAGAGGTCAATGTCATCTTTTAAGAACCGGACCTAATGAAATAAAGCATGGAATATAAAATGTTGATTAAAATATACAAGGAGAAATATTTGAATTTTGGATCTAAAATGATTAAGTTTTCTAAAAAGAGGAAGGTGAATAAGCTACCTACTAGTTTGATGTTGTTAGAAAGTAGCTAAATACATTATAAACTGTTATTTAAAATGATAATATTGAATTGAGCATTTGTCATCTTGATAAAAACAACACTATTACAATTTAGAATGAATCTTTGAAAAATATATTTATTTTAAATTTAAATGGCCCTGCTATCATTAATGAAACTGTTAAACTCAATGATCGTGATGCCTTTACTGAAGTCTGTGCTTCCTATAATTTAAAATCTACAGAAAGCTGCATAACTTTATTAATATTAAAAGCAATTTGA