TTHERM_01107420

Length: 786 bp

cDNA Sequence

ATGTTTGAAGCTAAATTACAATAAGGTGTTATTTTCAAAAAAATCGTCGATGCTATCAAGGATTTAGTTAAATCAGTTAATATCGATGCTAGCACTAGTGGTCTTTCCATGCAAGCTATGGATTCAGCTCACGTTGCTTTGGTTTCCCTCAAGTTAAATGAAAATGGTTTCAAGGATTATAGATGTGACAGACCAATCACTCTTGGTCTTTCTATTGAAAACCTTTCCAAGATCCTCAAGTGTGCTGGAAATGATGACACTATTACCTTATAAACTGATGAAGAAGAACCTTCTTCCCTTAAATTCTTCTTTGAAAATTAATAGGCCTCTAAGATCTCCGAATTTAGTTTGAACTTAATGTCATTAGATAGTGAATCTTTGGGTATCCCCGACACCGATTATTCTTCTGTTATTCAAATGTCCTCAGCTGAATTCTCTAGAATCTGCAAGGAACTTAGTTCTATTTCTGAAACAGTTGAAATTGAAACTAGCAAAGAATCTGTTAAGTTTAGCGTTTAAGGAGATATTGGTGCTGGTTCAATCACTGTCAAGAATAACTAAAGTGATAAAGATGTTGACCGTGTTGATTTACAAATTGATTAACCCGTTAAGTTAACCTTCGCTCTTAGATATTTGAATATGTTCAATAAGGCTGTCTCTCTTAGCAGTACTGTTAGTTTAAATATGTCTGAAGAAAATCCTCTTATGGTTGAATATAAAATCGATGATCTTGGTTCTCTTAGATTCTATCTTGCTCCTAAGATTTCTGATGAAGAAAGTAGTTGA