TTHERM_01108740

Length: 2874 bp

cDNA Sequence

ATGAGTGTCACACTTTAGCAACCAGTTGCTTCCAAATCAGATGATAGAAAATACAAATTAATTAAGTTACCAGTTAATGATATTGAAATTTTATTAATTTCAGATCCTACTACTGATAAGAGCTCAGCAGCAGTAAATGTAAATGCTGGCCAACTTTAAGATCCAATTGAAAGATAGGGCCTTGCTCATTTCTTAGAACACATGCTCTTTTTAGGTACTAAGAAGTATCCAGATGCTTCACAATTCGATTAGCATTTAAATCAATATTCAGGATATTCTAATGCATTCACAGCTTTAGATTAAACTAACTACTTCTTCCATTGCTCTAATGCAGGATTTAAAGAAGCTCTTGATAGATTTGCATGGTTCTTCATTGAGCCACTATTTACTAAGGAGTTGACATCTAGAGAAATGAATGCAGTAAATAGCGAAAATTAAAAAAATTTGTAATAAGATCTATGGAGGGAATATCAATTAAATAGATCCACAAGTAAAGAAGGAAATCCTTTTAATAAATTTGGAACAGGTAATCTCGAGACTTTGAATTTTGAATCAACTCGTGAAGATCTAATTAAGTTCTACAATTAATACTACTCTTCAAACCTTACTAAAGTTGTCATTCTTTCAAATGAAACTTTGGAGGAACTTGAAACTTAGGCTGTAGAACTATTTTCTTAAATACCTAACCGTAAATTACCAAAACCTGTTTACAAAGAAAGCCCTTTCGATTCAACTAATCTTAAAAAGTTCTTAAAAATAGTTCCTTGCAAATAAGAAAAAAGATTAAAATTCTCTTGGGTTTTGCCAAATTATGAAAAGAATTACAGAAAAAATCCAACTAAATTGTTCAGCTATCTTTACGGACATGAAGGAGAACACAGTTTATTAAGTGCTCTCATGGATGCCGGATATGCTGAGGCCTTGAGATCAAGTGAAAGTTAAATCATGGGATTATTTTCTTAGCTCTCTGTGACAGTTGTTTTAACTGAACAAGGTTTTGAAAATTATGAAAAAGTAATTAATTTTGTTTCTGCCTACACTAAGATGCTCAAAGAAAAGGCCAATTAACAATGGGTTTATGATGAATTCAAGAATATTTCATAGTTGAAATTTGACTTTAAAGATAAAGAAGAACCTATTGATTATACATATGAAATTGCTACTGCCATGCAAGAGTGTGAGTATATTGATATTTTGAGAACAGACAACGCTCCAGAGCCTTATGATAAAGACTTATTATAGAGTGCTCTCGATGCTTTAATAGTAGACAATTTAAGGATTACTTTAATATCTCCAACTTTAACCGAAGAGTGTAATTTAACAGAAAAGTACTATTAAACTAAATATTCAATTGAACCTATCTCTGAATCTATTATCAAAGCCTTTGAAAATCCATAAATACCTCATGATAGCAAGAAAATGGATTTACCTCCTAAGAATACATTACTTCCCTAAAAATTCGATTTATTTACAAGTGAAACTGATGCTCCTCCTAAGGATCTTTTAAATAACGAATTTATCGAACTTTGGTATAAATAAGATAGCTAATTTAAGATTCCTAAGGTTACATTGAAGTTACGTTTTAAAAACAATGACTGTGGTCTTGGATTGACTGCAAGAGCTGAAGTCTAAACTAAATTATGGACTAATTTATTCAATGAATTTACTAGAGAATTAAGATATTAAGCAGAGATGGCATTACTTGACTCTAATTTAGAATTTAAATAAGAATTAACTTTAACAGTAGACGGTTTTAGTGATTCTATTACTAATTTTATGGAACTTTACTTACAAAAATTAGTCGAATTTGATGTATCCAAATTATAAAAAGAGTTCTAGATTTAGCTTAATAAGCTCTAAAAAGATTTGAAAAATTTCTTTAAACAACCACCTTATCAGCAAGGAAATACATATAATGAATATTTCCTCTAAACCAGAACTTTTTCTCCCAAGCAATTATAAGAAGAGTCTCTTAATATCCAATTTGATACCTTTGTTGAATTCAGTACCAATTTCTTGAAAGCACTTAGACTCGAACTCTTAATCGGTGGAAGTTTAACTTCCGAGTCTGCTCTAAATATAGGCAATATTTGCACTGCTCACATTTTTGAGAAAAGAGGAGCAAAGCCTGTTAAAAAGTCCGACTTAATAGACAGAAGAGTAATCTAACCTGCAGTTGACCAAGTATATGTTTATACAGAGACTCTAGGAGAAGAAGAAACAAATAACTATATCTGTGCTAATTACGAAGATGGAGAAAGTGTCTCAGTAAGAAGCAGGGTAATAATGGAATTACTAGGAAATGTTTTTTCAGAATCTTTCTTTACTTAATTAAGAACTAACGAGTGTCTTGGATATATTTGCTGGTCCAGAACAAATGCCATCAGAGGTGTTGGATTTGTTAGATTCATAATCTAATCAGATGTTCAACCTCCTTAGTATCTTGCATCTCGTATTCATAGCTTCTTATAATAATAGAAAATTAGATTAGAAGAACTCACTTCAGAATAGTTTGAAAAAATTAGAGCTGCTGTAGAGGTAGATATTAGAGAAAAAGACTTTAGCATCAAAAAACAAACAGAAAGATACTTTGAATATATTGTTTAGCATCACTATACTTTTGACTTGAAGGAAAAAATGATTGAAGAGCTCAAGAAAATCAAATTAGCTGATTTAGTACAAGCCTTTAAAAAGATTTTCTTCACAAACAAAAGATGCAGCTAACTTCATTTAGTCAGTCCTAAGCACGTTGAGCAAAATGCCCTTTATATGAAAGTAACCTAGCCTTATAGTGGATTTGAAAATATCACTAACCCTGAAAGTATTAAGTTTAAGTGCTCTCTTCACCCAGACTACTATACCTATAAAATATGA