TTHERM_01123860

Length: 3669 bp

cDNA Sequence

ATGTCAAACGACGACACGGGCGTGCAAAATTTAGATGATTAGGATTCGAAGCGCTTTGGATATGACTACTAATATGCTAATGTCTCAAAGGACAATAGGTCTTGCCAATTTTTTTACTATAATTAAAACAAGTTAAAGTATTAAAGTGAACCTAGAAAAATTACCACTGGTAGACCCGATGAGTGTCTACCTAACAATAATATAAAGACTAACAAATACACTTGCTTAAATTTCTTTCCTAAAAACCTCTATTTATAGTTTAGCAAATTAGCAAATATTTATTTCTTGTTTATTGGTATTATGTAGTCTATTCCTTAAATTTCTATTTCGAATGCTATACCTGTCATTTTTCTTCCCTTAGCTGTCATAGTTGCAATCACTGGAGGAAAAGATTTATATGAGGATTATAAAAGAATGAAAAGTGACAGAACAGAGAACGACTAAAAAATTTAAATTTTTGATAATAAATCAAACAGTTTTAAAGAATTTACTTGGAAAGAAATACGACCTGGGCATATTGTCAAAGTAATGAGGGACCATTATTTTCCTGCTGACGTAGTTTTATTAATGACTTCAGATCCATAAGGGATTTGCTATATCGAGACAAAAAACCTAGATGGTGAAACAAATTTAGAAAGTAAACAAGCAGATCCTCGTATAAGAGATAAATGTATTAAAGATGAATCTAAATTAGGCTAAGAATGTGTGATTATACATTATGAAAGTCCTAACAAAAGAATCTATCGTTTTGATGGAAGTTTTGACACTAAAATGGGTGAAAATTATCAATTGAGTTACACAAATGTAGTTCTTCGTGGATGTTGCCTTAAAAACACTGAATATGCTATTGGAATGGCTGTTTACACAGGACATTAATCTAAGATTATGTATAATCTATATTAAGGAAGTGCTAAGAAAAGTACTCTAGAGCAACTTATAGGAAAGCTAATCATTTAAATTTTTTTGTTATAGTTAGTTGTTTGTATTATCTGCGCATCTATTTATATTGGATTTTATTCTTTGGTGGGCTACGAGCTAAGTTACTTAGTTATTAAGGCTTCATCTGATGTCTACGAAGAAGCTAATGCAATCAACTTTTTTGTAAGACTTGGTAACTGGATACTCATTTTCACTCTTATAGTGACATTAGAAACTGTTAAATTTATTCAAGGAATGTTTATGACAGCAGATGAAAAAATGGGAAACCCTACTGTATAAGCTTCTAATTTAAATGAATAATTAGGATAAATAAATTACATTTTTTCTGATAAAACTGGTACTTTAACTAAGAATGTTATGTAATTTAAGCAAATAGCTATTGGGGACACTCTTTATGGAGGAAACGAATAAAAATCTGAACAGCCTCTTACTGATGAAGAAATTATGTTCAATTATCCTAAAGTAGAGAACGTTGATTTTAGAGATAGATCATTTTTAGATAAAGTTAAGGATGAGGAAGATCCTGAGCATGTGAAAATTCGTCGAGTATTGTTTATGCTAGCCTCTTGCCATACTGTAACTTCGACAATAGATCATTAGTAAAACACTATCTATACAGCATCTTCCCCTGATGAATATGCAATTATTAACTTCACTAAATTTGCTGGTGTTGAATTTTTAAAAGTAGAGAAAGTAGATGGAAATACAAATATATTGATTAGGTTTAAGCAAAAAATATTTTCTTTGCAATTACTGCATGTATTTGAATTTGATTCGAATAGAAAGCGCTAGTCTGTTATTGTCAAAGACTAAGATGATAAATATTTCTTATTTTGTAAAGGAGCAGATTAAGTGATTACTATGAATCTCAGTGAAAATACAGACCCGATTATGCTCAGAAATTTGAATGAAAAATTAAAATACTTTGGTAGTCAAGGATTGCGTACCCTCATGCTTGCTGAAAGACAAATCGATAAGCAAGCATATGAAATATGGAGTGAAAAGTATTTAAAGGCACGTTCATAAGCAGAAAACAAAGACTTAGAAATCGAAAAGCTTTAGGATGAAATGGAAACTGATTTAGAAATTTTAGGAGCTACTGCTATAGAAGATAAATTGCAAGATGATGTTTCAGATACTATTAAAGCATTGAAAGATTCTGGAATAAAAATTTGGGTATTAACTGGTGATAAAATAGAAACAGCAATAAACATTGCCTATTCTTGCAAATTACTTGATGATACTTTAGAAAAAGCAATTATTGATGTCGAGGAAGAAAATGAAGTTAACAAATTCCTCTAGGATACTCTTTAAAACCTATTAGATGCTGAAGCAACATATATTTAATAATAAAAATAAAATAAAAAAGCAATAGATGAAGATGCTTTGAAAAACCATGCACTTATTATATCAGGTTTTGCTCTAAATCATATTTCGAAGACAGAAATAAAAACACTTATTATGCAAATTGTTAAATATTGCAAGTGTATTATCTGCTGCAGAGTATCCCCAAAATAAAAATAAGAAGTTGTTACTACAGTTCGTGAAATGGAAAAGAATGCAACAACACTCGCTATTGGTGATGGAGCTAATGATGTAAATATGATTACAGCAGCTCATGTAGGAATTGGTATAAAAGGTGTAGAAGGTTAGTAAGCTGCAAGAGCTAGTGATTATTCTATTAATTAATTTAAGGAATTAAGAAGGTTGCTATTCTATCATGGTAGAGAATGTTATCGTAGAAATTCAAATTTAGTACTATATAACTTTTACAAGAATGTCTTGCTTGTGCTTCCTCAATTTTGGTATGGTTGGACTAATTGGTTTAGTGGCTAAACACTATATAACTCCTTCATCTATTAACTTTTTAACATCTTCTTTGCATCACTTCCTATTATGGTTTATGCAATATGGGATGAAGAATATTCCGATGTAGTGCTCGTGAAAAATGAGAAAAAGAATTACTACGAATAAGGAATAAAAAATAAGCTTTTCAACCAAAGAGAATTCTGGAAATGGAATCTGATAGCTTCAGTACAAGCTGGATTGATTGTCATATGTTCACTTTTCCCATTAGAGCTGAATTTTGTTACATAAAATGGATAGACTTAGTGGTTTTGGGCTACTGGTACTATGGTTTTTGGTTTAGTTGTAGTTATTTCAAACTTAAAAATCCTAATTATGTCAACAGATCACTCTTTGGGTTCTTTAATGATCTTAGCTTTATCTATGCTTCTTTATTTGATTACTTGGGTAATCGTGAGCAATTTGAATTCCACAGAAATTTATAGAACTCTTGGATAGTAAAATAATTTTAAACATCAAAATAACATATAAATAAATAAATTAATTAATTAAATTAGAATGTTCTAAACTCCTAATTTCCACCTTGGTAATATACTATGCATAATTGTTACATCATTCTTTGATTGGGCTTTTTGTTTGTACAAAAAATGGACTTATGAGTTTGATGAAAAGTAGCAAGTAACTAAGATTGATAAGACACCAAAATAAGTTAAAACAAATAGTACCTTCCCAATTAAAATGCGTACTTTTAATACAGATGTACCTAAAAAATAAAATGGTTTTGTCAAAGATCAAACTAAAGCAAATTATGCAACATAAGAAATGAAAAGAACTTATTATCAAGATGTCAATACTGGTTATGCTTTTAATTAGATAGATAGACACTAATATGTCTAAAAATAGAAAGAGTAGCAAATGTTTTGA