TTHERM_01123950

Length: 456 bp

cDNA Sequence

ATGGCTGGCCCTACTCCTAGAATTATGAAAGAAACTCAAAAGCTTCAAACAGAGCAAGTCCCTGGTATTGATGTAGTTCCAAATAAGGACAACTTCCGTCACTTCTACGTAAAGATTCAAGGTCCTGATAACACTCCTTATGCTGGTGGTATCTTCACTGCTGAATTATTATTACCCGAATAATATCCTATGAATCCTCCCAAAGTTATTTTCTGCACCAAGATTTATCATCCTAATATTGATAACCTTGGTAGAATTTGTTTAGATATTTTGAAAGATAAGTGGTCTCCTGCCCTCTAAATTCGTTCTGTCCTCCTCTCTATTTAGGCTCTCCTTTCATCCCCCAACCCCGATGATCCTTTAAATAACGAAGCTGCTGAATAATGGAAAAATGACGAACAAAATGCTTTGAAAAAAGCCAAGGAATACACTTAAAAGTATGCTACAGGAAAGTGA