TTHERM_01125120

Length: 1044 bp

cDNA Sequence

ATGAATAAGAAAATTCTTTCATTATTGGTTGCTTTAACCTTATTACAAGTCGCATTAAGTGCTGATTGTGACTTTTGTAAATTTAGTGCTGATGGTACTGATAGTGCTGGTGCTTGTACTGATTGTGATCCAAATACTTGCACTAAGCAAACAAAAGCTGCTGGTGCTAAGGAGGATGTTTGTACTGCTTTACCTTGTCCTTAAGGTACTTACAGTGCTATAGGGTTTGATAATGATGGTAAAGGAGGAAACTGTTCAGCTTGCGATGCTGGTACTAGTACTCCTGCAGCTTAAACTAAGGGAACTGATAAATCAGTTTGTACTTTAAAGGCTTGTGTTCAAGGTACTTTTAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAAACTGTTCAGCTTGCGATGCTGGTACTAGTACTCCTGCAGCTTAAACTAAGGGATCTGATAAAACAGTTTGTACTTTAAAGGCTTGCTCTCAAGGTACTTATAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAAACTGTGCAGCTTGCGATGTTGGTACTACTACTTCTGCAGCTTAAACTTAGGGATCTGATAAATCAGCTTGTACTTTAAAGGCTTGTGTTCAAGGTACTTTTAGCTCTACAGGTTTCGATAATGATGGTAAAGGAGGAGACTGTACACCTTGTGATGAAGGTACTAGCACCGCTAGCAATTAAACTTAGGGAACTGATAAAGCTACAGTGTGCACTCTCGTTTTGAAGTAATGTGTTGCTGGTACTAGCAGCGCAACAGGTTATGACACTGACGGAAAAGGAAATGGTTGTAATCAATGCGGAGCTAATACTTACTCAGCAGCTGGAGCTAAAAATTGTACTCCTTGCGCTAATAGTCGTGTTGCACCTGTTGGTTCCACTGTAGTAACTGCTTGTGCTTGTCCTGAAGGAACTACTGGTCCTGAAGATGGCACAAGCGTATGTGAAACAAGCACTAATTCTAACTCTAAGCTTATTCAATTTGTCTTAAGCTTCATCTGTTTGGTTCTTCTTTTCTGA