TTHERM_01142760

Length: 333 bp

cDNA Sequence

ATTAGATTAAAAGATATTTCTAAATTCAACTTAATAGCAAGTAAAATCAAGAATATTAAAATGAGCTCTGGAGATCTTCCATCTGCAACCTTAAGCATGATTTAATAAGGTCAAGACCCCAAAGAATTGGTCCTTTAACATTGCAAACCTAACTGTCTTCACTGGGAATAAAAACTTAAGAGATGTGAAGCAAAGTTAAGAGAACTTGTTAATGCTGATCCTGAAATGTCATGCATGTATCCTCTTAGAGATTGGGTTACTTGTGTTGAAGCTTGCGTTTAACCTCAAATTATTTCTTAACTTGTTGGTGCTTAGAAGGGAAGAATTTGGTGA