TTHERM_01145010

Length: 2514 bp

cDNA Sequence

ATGGAAGTTAAACTTAGAAAATTCACAACCAAGGGTTAAGCACTTGTTGCTTCAGCCAACCTTTTCCATGAGGAAAAAAAGATTACATTCTCAAGGGATGAATCTGTAGCAAATGACACTCTTGCTGTCTAAAATTAATAAGCAATTAGCGGATGGACTGCTATTTTCTCTTATCTCCTCTAGTTAAAGATTGATAGTCCTTTATTTGGTGATTTCTACTTTGTTTGCAACTAATTGAAGAGTGGTAAAAGATAAGTAGAAGAAAATGCCTTAGAAAATTTGAATAAAATACTTTCTACCAGATAATTCTTAAGCGGAGAAGAACTTGGTGAAATTGATGTTATTGCTTACACTCGTGTCAGAGCCTTTGTTAAGGATCTTCCTTTCAGCATTAAGCGTTTTACCCATCTCCACGATTGGTTTGTTGCTGCTTAATCAACCTTAGAAGATGCTGTTAGCAAAGCTGAAACTTTCGTTGCTTAACCTGTTGTTAAGGAAAAGAAAGCTGCTGGAAAAAAACCAGAAGGCAAACCTGAAAAACCAGAAAAGGCTGAAAAAACTGAAAATCCTAAAAAGGCTGAAAAAACAGAAAAAGCTGAAAACCCTAAGAAGGCTGAAAAGGCTGAGAAAAAGGAAGCCAAAAAAGAAAAGGCTGAAAAACCTGCTGCTACTGAAGCTCCTAAAAAGGCTCCTGCTAAAGTTGATACTATCGATCCTGCTTATAAGGAAAAAATTAACAATATTAGATTCGTTAGAAGCAATAAGGGTGAACCCGTTTTACCAGTAGATGGTTAAAGAAACATTTTGATCACCTCTGCTCTTCCTTACGTCAATAACGCTCCTCACTTGGGTACATTGATTGGATGTGTCTTGAGTGGTGATGTTTTTGCTAGATATTGCAGATCTAGAGGTTATAATACAATTTACATTTGTGGTACTGATGAATACGGTACTGCCACTGAAATGAAGGCTCTTCAAGAAAAGACTACTCCTGCTGAAATTTGTACTAAGTACTATAAGATTTAAAAGGATGTCTATGATTGGTTTGATATCGATTTTGATATTTTCGGAAGAACCACTACTGAAAAGCACACCAAGATTTCTCAAGATATTTTCTTAACTCTTCATAAGAATGGTTACATCAAGGAAGACATCATGCACCAAAGTTTCTGTGCTGCTTGTGATAAATTCTTAGCAGACAGATACGTTAACGGTACTTGCCCCTTCTGCTAACACGATGATTGCCACGGTGATTAATGTGATAAGTGTGGTAAACTCGTTAATCCTGCCGAACTCATCAATCCTAAATGTACAATTTGCAAGAATCCTTCTGTTATTAAAGAAACTAAGCACTGCTTCCTCGATTTACCTCAACTTGAAAAAGAAATCGACGAATTCATTGAAAAGAGATCAAAGGAAGGAGATTGGAGTGATAACGCATATAAAACATCCAAGGCTTGGATTAAGAATGGTTTAAAATATAGATGCATTACTAGAGATTTAAAATGGGGTACTCCTATTCCTCTTGCTGGTTGGGAAAACAAGGTTATGTACGTATGGTTCGATGCTCCTATTGGTTATCCTTCCATTACTGCTAATTTGGTTGAAGACTGGGAAAAATGGTGGAAAAACCCTGAAAATGTTAAACTTTATCAATTCATCGGTAAGGACAATATTCCTTTCCACTGTGTCATCTTCCCTGGTACTCTCTTGGGAACTCGTGAAAACTGGACACTACTCAACTCTATGTCATCTTGTGAATATCTTTAATACGAATCTGGTAAATTCTCTAAGAGTAAATGCGTTGGTGTATTTGGTGATGACGCCTAAAAGACTGGCATTCCCGTTGAAGTTTGGAGATATTACCTTTTGATTAACAGACCTGAATAAAACGATACTAATTTCTAATGGAGTGACTTTGCTGCTAAGAATAACAACGAACTTCTTCCTAACGTTGGTAACCTTGTTCAACGTATTTTGAAATTCCTCTACTCTAAGTTAGAAAAGAAAGTACCTACTTTAGATTTCAGTCTATTGAACGAAGAAGATAAGAACTGGTTAGCTTCTATTTGGAATTTGTTCCAACAATATCTTTCTCATATGGAAAAGGTAGAACTCAAGAGTGCTCTTAAGGTTGTTATGTAAATTTCTTCTGAAGGTAATAATTATATGCAAAAGAATGAACCTTGGAACAAGGCCAACCAAGAAACTGGTAGACACATTGTCTCATTGTTCGTTTTGGTCAACATCATTAGATTCCTCTCTGCCTTATTCGAACCTTTCATGCCTACTCTCAGTGCTAAAATTAATTTCATGTTGGGTTACGAAGCCAGAACCGCTAAAGATGAAAAGATCCTTGAATTTATCAGTTCTCAACCTGATGCTATCTCTGGTCTCCTTTCTCTTGTTCCTGGTGGATAAATCTTAAATGAACCCATTCCTATTTTCAGAAAATTGGAAGATGATGAAATTGAAAACTTCAAGTTATAATTCAGCGGTGGAAAGAAATTGTGA