TTHERM_01161020

Length: 855 bp

cDNA Sequence

ATGAATCAAATTAGAAAATGCTTAGTAGGTGTTGTTTAGATGTGTTCTACTCACAATAAAAAATAAAATATGGAATTTATTCTTTAAAATTTAAAATAAGCTCATGAAAAATAAGCGAAAATATGCTTTTTTCCTGAAGCCTTTGCAATGATTTCTAGAAGTTTTGCAGAAACATTTGAAAACGCAGAATATATTGATGGTGAAATGATAAATTGCTTAAGAGATCATGCTAAAAAGTATAATTTGTGGCTATCGCTTGGAGGCTTTTAGGAAAGATTAAAAGAAAATGATAAAAAGATGGGAAATACTCATATCATTATTGATAATTTAGGAAACATAGTATAAACTTATAAGAAGCTTCATCTTTTTGATATAAGCATCGACACAAAAAACACAATATCTGAAAGTAGTGGTTATGTATTTGGCGACTAAGTTCCAAATGTTGTTGACTCTCCTGCAGGCAGGTTAGGATTATCTATTTGCTATGACTTGAGATTCCCTGAGCTTTTTAGACTTCTCGCAGTTCAACAGAAAGCTGAAATATTATTAGTTCCAAGTGCTTTTTTTAAAAAGACTGGCTAAGCTCACTGGCATACTCTACTAAAAGCTAGAGCCATAGAAAATTAATGCTTCGTTATTGCAGCTGCATAAGCAGGATAGCATAATGATAAAAGAGAAAGCTATGGACACTCTTTAGTTATAGATCCTTGGGGTGAAGTATTATTGGATATGGGACCAGAAAAGCTTGGTATTGATTTTGTAGAAATAGATTTGGAAAAAATTGATACAGTCAGAAAAGGTTTACCAGCTATAAATCATATTAGAAACGATATTTACAAGCTATCTAAAATTTGA