TTHERM_01166280

Length: 4656 bp

cDNA Sequence

ATGTCGCACAAAGTGAGAGACTAAGAAGAATCTAACAGATAAACAATATATCTTAATGATCGTACATAAAATCAATTGATTCATAGAAAGTTTTACAATCATATAAAGACATCAAAATACACATGGTGGAACTTTGTTCCAAAGGCGTTGATTTTGCAATTTATGAGAGCAGCTAATTTTTATTTCTTAATTTCTACTGTTGTCCAATGTATAGATATCATTTCCCCTTTAGCGCCTTTTTCCGCGGTTGGCCCACTCATATTAGTGCTTGCCGTATCTTTATCAAGAGAAGCAATTGAAGATTATAAAAGACACCGCAATGACGATCTTGTCAACGAATAGAAATCATTTATTTTTAATAACAAAAACTTTACAAGCATTATGTGGAAGGATATTTAGCTTGGCGATATTATAAAAGTTAACTAAGAGCAGATATTGCCAGCAGATATTTTGGTTATTACAACAAATGAAGAAAACGGCACAGGTTTTGTCGAAACTGCTAACTTGGATGGTGAGAGAAACCTAAAAAGCAAAATATCTCATGAGATTGTAAACAAGTACGGTAGAGAACATTCTCTCATTAAATTCAAGGGAAAAATTGTTTGTGATAAACCTAACAACAGAATCCATAGTTTCAAAGGTTTGCTCTATTTGGACGACGAATCGAAACCAATAGTACTCAACAATAATAATGTCATGCTCAGAGGCACAACTTTAAAGAATACTGAATGGGTGATAGGAGTGAAAAACACAAATCCTTTGGAAAATAATAAATATAACTACGCTTATCTTTATGGAAACAGTAGCGATGGTCTTTATAGCTATGAAGTTTAGGGAACAATCAATTTTTTTTCATACTTTTTACTATTAAATTCACTTATTCCTATTTCTTTGATTATTTCTATGGAAGTTGTCAAACTATTTTAATCATCTTTCATGGAGTATGATGCTGAAATGCACTATTTAGACGATGGATAAGTTCAAAAAATGAAGGTGCTCAATACTATGATTCATGAAGAGTTAGGAAAAATTGATTACATCTTTACAGATAAAACAGGAACATTGACTTGCAACATTATGATTTTCAGACATGCAAATATCGCTGGTTCTGACTACTCTGAAAAAGAACTTGAAGACATCTTAGCAAAATTAGAGTATCAAACTCTCACTTACGATGAAGAATACAAAGATTTTTATCAATTTTGGATGTGCATTGCTATTTGTCACGACGTTATCCTTGAGGAAAAACAAAACGAAATTAATTATTAAGGTTCATCACCAGATGAAGTATGTCTCGTAGAAAAAGCTCAAAAATATAATTTCAAATTTCTCAAAAGAACAACAAATTAAATATTTATACAAGTGGGATCAGAAATGCATACATTTAAGCTTCTCAATAAAATAGAATTCACAAGTGAGCGAAAAATATATATGTACACTAAGGGAGCTGATTCGTTCATGCTCAAACATATTTCGAATACAAGTGAAGCACTTAAAAGTAATATAAAGCAAAGCCTCAAATACTATTCAAAGCACGGGTTAAGAACTCTCTGCTTGGGTATGAAAGAGTTAAATCAATAAGAATATGATGCATGGAATTCGCAAATACAGGATTTAAATATGAACATGATTGGAGACTTGTTCCCTGAAAAAACTAAAGATAAAATTGCTGATCTTGAAAATGAGATAGAAACAGGCTTTGATCTTTTGGGAGTTACTGCACTTGAAGATAAATTGCAAGAAGGAGTTCCTGAAGTTTTAAAGGATTTCCATGAAGCTGGAATCAATGTTTGGATGCTCACAGGTGACAAACTTGAAACAGCAGAAAATATTGGTTATCTTTGCAACTTGCTGAACAATCAAACTAAAGTGTTCAGAGTTCAATCTCACTATCCAGACGTTACGAGAGACAAGTTCTTTAGAATAAAGGGAAGAATCAACCAAATAAAAACTGTCAGCGAAATAGGAGAAATAAGAATAAAAAACAACTAAAATAACCACCATGATTTCAAAAACAAAAAAGTTGGACATTAAAACCAGAATATAAACAGAATAATAAACGATGGAGGTTCCTAATCGAGACGAGATTCCTATCTAACTAAAGAAGAAAATAATTCATTTGAAATAAACTAAGTGAAAGGCTACACAGGATTTGCCTTGGTAATAGAAGGAGAAGCAATCGGTCATGCCTTACATGATGATTAATGTAGAAAAGAGTTCTTGCAAATCATTCCAGAATGCTGCACTGTTATATGCTGCAGATCAACTCCAACATAAAAAGCAGAAATGGTCAAATTCGTTAAAACTCATTTTAATAAAACTTGTCTAGCTGTCGGAGATGGAGGTAATGACGTAACCATGATCTAAGAAGCAGATATCGGAGTTGGTATTATTGGTAAGGAAGGAAATCAAGCAGCTTTAAGCAGCGATTATTACTTTGGGTAGTTTAGGTTTTTGTGGAGACTTTTGTTTGTTCATGGGAGATGGAATTTATACAGAACATCTTACTTTGTTAACTATTTCTTCCTTAAAAATTTTATTTTCACACTTCAATAGTTCTACTTTGGGTTCTTTTGTGCTTATTCAGGGTAGTCTTTTTGGGAAGACGGTTATTTACTCAATTTCAACTCTATTATTACTGCTTGTGCTCCAGTTTATTTTGCAGGGTTTGAGTAAGATGTCAATCCTCATGGATCTGAGTACATCGCTAAGTATTTGCCTCGTCTCTACAAAATATTTAGAGAAAAAGATCTTTTTTCTTTTAAGGTCTTCGGAATAGTTTTCTTATAAGGTGTTGGCCTTTCTCTTACAACTTATTTTTCTGTATTTTTTATCAACTATTAGATGAGCGGAGATGGTAAAATCGATGGTTTGTGGTTTTAAAGCTTTTCTTCTTACTGCAGCACAGTTGGAGTGGTTTGGGCTATCAATTTTATGGACACAACATATTTTTCACCATTTACTTTCTTTTCTTACGTGATTGTTAGTTTGTTCTTATTCTTCCCTGCTTTCGCTTTTACTTATGACATTTTTGCTGGTCCCTTGCAAGAAATGTTACTTATAAACATTGGAAATTGGAAATTCTGGTTGACTTTGTTCTTAAATGTTGCTTTTATCTGTATTATTAAATACACATATAAAGTTTACAGATACATATTTGCTCCAGAATTAGTTCATGATTTGCAATATCACAGAAAGAAGTTAAACGAAGCTGAGAAGTAAGTTAAAAATCAATAAACTGATCCTAATATTAATAATAGCAATAATGCTAAAAATAACAACAACAATAATAATGCCTACACTACTCCTGAAAATGGTTTACAAATCGAAATTGCAGATAATATCCAATAAAATGAAATTGCACTCTAAAATCCATCTAAAAAATCTGTAGAATTAGAACATAAATAAGAAAAGGCTTCAAAGAGGACTGCGTCTTTATAAAATGTGGAACACTAACAAAATTTAAATGTCGAATTTACTGATTTAAAACTTTAAATGAATCATGATCTAGATAAAGGCAGTGGAAGAAAATTAAATAAACCTCAAAGCTAAAATTTCATCACTATTTAAAATAATGATTAGAGCGTGCTTCATAGCGAACAAAGTAACATGGTGAATTTTAATAATAAATAGGTCACCTATAAAAATATCAATCACAATAATGAGAGCACAAGAAGTCTAATTAAAAATCACTACAATAACAACATTCTAGCTGTAAATAATGCTTATTAAAATAATAACATAATCTCTAATATGCATACAGCCAATTAGCTTAGTAATAATAATTTAATTAATAATCACAGTGACAACATTTTAGTTAAAAATTTAAGCGAATCTTCTTAAAACTAATCAAATAAAGCTCAAGAAAACGATCATCCTTTGACTGTGTTCTAGAAAAATAAGCAATTTTACATTATTAAAAATGAGATTTCTGATCATCCTCAAATACATGCCAATAACCAACTTAATTTTATGGAAAATAACGATGAAGACGAAGAAAGAGCCTTTAGTTAAAATAGCTAGGCCGCAAGTGATAATAAGAAAAAAGGCAGTCCATCTAGCGATTAAAATGATAAAGCGAAGTAGACTAGTGTCAATGCGTTTGTGCAAGAAAACGAAGATTTTAATGACGATGAAATGAATGAATACAGCAACAGCATCAATAAAATAAACAAACTCCCAAAAGAGTAAAATAAAAAAATCAGTGTTTATGAAAAAGAGTCTCAACTCCAATCCAAAATCCACACGAATAAAGGAGTATTTGGAGAAGAACCTGACAGACCTTCCCATCTAGGCGACAGCAAAAAAATATACATTGGAAATGACTAATTTGAAAGTGTAGCAGAAACTGTCCCCAAAACAAATGTCCTAATAAACAATGAAAACGAAACATCTCAATAACTTAAAGAGTTGAATACATTCAATATCAACTACCAAAATACTAAAGTTAATATCATTTAATCTGAGAAAAACTCAGAACTTCCCCCCGCAACCCGCTACGAAGGAGTTAAAATACCTCAAGCTGACTCTGACAACGAAATCGAATATCAAACCGATAACCTCGATATGTAAAAAATGGAAGAAATACAAAAATATATGTCTAAGAGCAAGTTCTCTTAGCTTCCATAATAATAAGAAGATAAACACTAAGACTGA