TTHERM_01166310

Length: 2487 bp

cDNA Sequence

ATGAATATAACTCTTCTTGCGTCTAATTAATACTTCAAAGATTTAGAAATCACAAGAAAATGTTAGAATTCTAAAGGAAGGAGCCAAAATTTTGTAAAAGGCAAATCAAGATCAGTGATAAAGAGATTGAGATACATAAAATAAATAGATCCATCATATATCAAAGATATAACAGTAATTGAAAAAAATATTAACTTCCCTAAATACCTCAAGTTATTAGCTCATTACAATGATATTGAAATATATAAATTTAAATTTAAAAGGTATTTAGTTCAATGGGGATCTTAGTTAGTAACGAAAACAAGGAATAAATTAAATTCTGATATCATTAATGCTCTTGAATTTTTAAAGAAAAACCTTTAGTATAACTCAATAGCTATAGCTAAGGAAGATATCTAATCTTATTTTTTTGTAGTTGCTCCAAAATAATCTAAAAATATTAGCATTAAAATATTAAAAGGAAGGAAGGAAGAATACATATTAAAAAGATATGCTTGTTAAGTTTATTAATTATCAATACAAATTAAATAAAATATCAAAGTATCAAAGTAGAAAGTAGAAAGATAAAAGGAATAGTTTAGAAAGCAAAATTTAGTAAAACAAATGCTAATTAAAAAGTTAGGAAGGGCGATATTCGATTTTAAATGTTATGGGCTGACATTAATAAATTATAAAAAGGGAACTAAGAGTTTCATGAGTTTAGAAAATAATTACAGAGATATTTAATTTGATGATATAGTTAATAATTTAGGAGAAAGCCACAAGGAGTTGGCATAAAAATTCAAGGAAGCAGCGAAATTTTCTAATTTAACTGAGCTAAATGATGGACAAATAAAGATTATACTTGAAAACTATAAAAAAGAGACAGGAGAAGTAGCAATTGATTCTAAAACAGTAAATAAGAAAGAAAATCACTTTAAAATGTTCTACAATCTTGTATAACTTGTAGAAAGAGATATCACTCTTCTTGTGGCTAATTAATATTTTAAAGATTTAGAAATCACGAATGGATAGAGTTTTAAAGGAGCCAGAATTTTGTAAGGTAAAGCAAGCTCAGGAGTAAAGGCATTGAGATACGCAAAGGAAATAGATCCATCGTATATCCAAGATATAACAGTAATTGAAAAAGATATTAACTTCCCTGAATACTTCAAGTTATTAGCTCATTACAATGATATTGACATGTCTAAATTTAAAAAGACAAACCACTTTTATTTGAGCAAAATTTTAGAGAACATGGATAAATATGACTAACCTGAGTTGTATGATTTTATAGATATTGAAGAGTATGGTTCTTCTATTGACACTATTCGTTAGGCTATTAAATTGGTTAAAAACGGCGGTATGATTTCTGCTATGTTCACAGATATGTCTACTTTATGTGGACCTAATGTTATAAAATGTTACAGCAGTTATAACAAGTTTAGAATAAGACTTGCTTCTTTAAATGAAAATGCAATCAGAATTATTTATTCTACTATTTTAGACATAGCAACTTAGAATAACTATTCAATAGAACCAGTTGTTTCTTTTTAGAGTGATTTTTATATTAAGATTTTCTTCAGAGTTCACCACAACGGAGTCGAATCTCAAAAAGCCCTTGAGAAGTTGAGCTTGGTTTACTAATGCAGTGAGTGCCCTAATTATCACGTTCATACAATAGCCAAAGTTTAATAAAATACTATTGAAAATGTTTAAAACGGAACCTTGAAGCTCGAGTCTTCAATGGACTTAAAATTGAATGAACTAAAAGTTCCAAGCAATTGCAATGTTTGCGAATCTAGCTGGATTCTGAATGGTCCTCTATGGAATTAGCCATTGCATAATTACAAATTTGTATAGAATGTGCTTAGAAATTTGTAATCAACTGGAAGCGAAAAGGTGTTTAGCAAAAATAAAATTATGCTCATTCAGTCTCATTTAAAGTTGACAGCTTATTTAGAAGCAATTCTTTAAGAGAAAGAATTCGACAAGTTTATTTTAGGCTACAATTTGACTTTGATCAATGGCTTCTATAAAGCAAAAACTTATCCTACCACAAATCACATTAAGAGAGCTTTGGCTAGAGCTGGATATACAATTAATAGATCAATTTTTGAGAAAAAGATTTACAAAACTAACGCCCCTTCTAATGTAATATTTGATACAATGAGAGGATGGAAATGGGTGAGTGATAAATTTAAAGAAGGTCAAAGCATGTATCCAAATTAAAATTAAACCAATTAAAAGCAGCCAGAATAAGAAGACTAGAACAGTCCCTATTCTAGAGCTATGCGCAAACAATAACAATTTTACCCTAAATTCTCCAAACTTAATCACCTCGAAATCGAAAATATAAAAAATAATAACATCGACATGGATTACTTTTAAAAACCATAAAAAACTGTGTTCTATCCCAACCCTACTGAAAATTGGGGACCAAAGAAACCCTTTTCTATTGCTTAAAAATAAATATTTTTGTTACAAAAATCCAAATAAAATCTTTGA