TTHERM_01184160

Length: 654 bp

cDNA Sequence

ATGAACAGCAATAATAACTATTAGCAGCTCAATTCTGAGCCAAATTAATTCTCTTAAGGATAAAATACACCAACAATATAAGCATAACCTCAACAGCCATAATTAATTTCATAGTTGCCTGATTTTTCAAATTATCCGCCACCCTCTTATGATAACTTTAATAATCAGATGCCTTAATAAAAATATTCTCCCCCTCCTCCTCCTCCTCTTTAAAGTTACGCTCCAAATCAAGCATAAAACTATCAAGCTCTTCCTTCCTAAAATTGTTATTAGCCTCCATTAACTACAAATTACCCATCCCCAGCTTAAAATTACTACCCACCTCCACCTTAAAATGGTCCTTATCATATTCCTTACTAAACAAATTAACTTTAACCATAGCAATATACTCCTATGTATTAGAATTAGGTAATGTTATAAAATGGCGATAATTTAAATCCTTATTAATTTTGCCCATAATGTAATTAAGTAAGACCAACAATAAAGTCTGGCTAGGCTGGTACTGGAGCAGTCATTTGTGCTTGTTTACTTTGTATTTTTTGTGGAGTATTTGGACTTTTTGCTTGTTGCTGTGAATAATGCTAAGATAAAGAATACAGTTGTTATGTTTGTCGTACAGTTTTAAAAATTGAACCTTACTAACCATGTGGTTGA