TTHERM_01207550

Length: 1311 bp

cDNA Sequence

ATGGACGGATTAATTGAATATTCTAATAGATACAATGGAGTTACTAAGATCTTTAAGATCATCTAGGGAGCTACTTTGCTTAAGCCTCCTCACATTAATTAGGCCTTCGAAACTGCCTTGATTTTAGCTTAGCAACTTAAAATTTACAGCATTTATAGATTTGTTGAGAGTACTGCTCTTGATTGGAAGATCACTACTTTAAGAGTTGACAAAGAATTAGCTGCCTAGTAATTCGCCCCTTATTAGGCTCAAGCAGAAAAGTTAGATAAAGAAATTAATATGCATAAAAACTCCTAAAATAAGCTTTCAACTGGTTTGTCTTACATCGAGTTAGGTAATCTATACCTCAAGGCAGGCGATGTTACAGAAGCATTTAGATCTTACGAAAGAGTGTATAAATATTATGAAGCTGGTGATATCTACTCATACTTCCCTTAATGGTGTGCTACAATGATAATAGAAAGAAGATACGATTAGCTCTAACAAGTATATCCCAAGGAGGCTATCCCTATTGAAAAGAAAAAAAGAGAGTAATACACCACTTTATTAGTTTTCTAAGCTCTCAGATGCCTCTACTAAGGATTTTAGAACGATTTCCTTTAAATTATTAAGGATGAGTTATAGCATGACTGCATAGTCGAAGATGAAAATTTGCTTCTTGTCACTAGCTTAAGAGAAATAGGTGTTTTCATCACTGTTTGTGCTTTGGCTCGCTTGTCAAGATCTCAAGTTTAAGATTTATTGAAAAGTGATAGTATTAGATTCTTTGTCACTTAGGATAATGAATGCTTAAACATCTTAGAATGTTATATAAGCTTAGATTACAAGACTTTGATTTCAAAGCTTAAATTATTCTACTAAGAATACAATTAGGATTTCATTTTTAAAAAATTCAACTTTTCTGAAATTCTCACTGACAAGTTAGTCAAGCAATATCTTTTACCTTATAAAAAAATTAGTATCTAAAAGGTTGTTAACATCATGGGTTTAAACTAAGATTTAGCTTTGGACTATTTAAAGAAATTAATCCAAAACAATTAAATTAACTTTTTGTATGACCCTATTGAAGAAGTTTTAGTCCAAAAGGAAACTGAAAAAACAAAAAAATACGAAACTTACTAGAAAGCTGTTAAGGTAATAGCAAGCTTTTTGCATAAGAAGCAAAAGTAAATGTTAAGATATCACCTAGGCATAGTCCATAGCGAAAACGGTAGCAAAAATAAATAGGATGTTATTGAATTAGGTAATATGCACGGTTTCTCAAGCTTAAATAAAGTTATTAATAATTTCATGAACTTTGAAAGCAGATGA