TTHERM_01246690

Length: 1305 bp

cDNA Sequence

ATGAATAAAATTAGCTAAAATCTTGTAGGATACCAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCTAAAAAGGAAAAAAATCAAAGAGATGTACCGAATGAAAGATGTCTAAATGCTCGATAAGCCTGAGTTAGTCATTTCTGATATCTAAGAACCTAAGTTAAAGCCTTATTAAGCTTTAATTTATTAGTCTATGAAAATCGAATTAAGTAAAAAAGGCTACTCTGATTTTAGATTTTTAGGACAGGGAGTATAGGGATTAGTTTTGTTAGCAAAAGATTCGAAAACTAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCAAGGTAATCTTGACGAAGATCTTAACAATCGAGTGAAACAAGAAGTAGAAATTCTCAAAAAATGTAGAGACTCTCCTTATGTAGTCAGTCTTATAGATTAATTTGAGGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAGATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAATGACATTGCTCAAGGTCTCTACTACATTCACTCTAAGAGCTGCCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTATCATGGAAATGCAGTTGTTTCTGATTTTGGTTTGGCAGATAACCTAATAAATAAATCTGGCTATGCTATGAATCAATATATGGGAAACTTCTTGTATCAAGCACCAGAGTGTTTTGACCCAGCTGATCCATTCATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGAGTCAGTGTGAGACAATAGCCAAGTAACAGAGGAATAGATTTGAGTTTTACATAAAATAAGCACAAACCATTAAATTATGATGGTGAATTTAAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGATGGATTAACTAATTTTGTTCCAAAGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGAAATGCTTATTGAGACGATAGATGGAAACACTCAGCAGTTCACATGTTCATTCAAAAATGAAATTGAGTTTGTTAAAGATTTGTCAAATAAGTTTTACCCAATCATAATATTATTAGAATTAGTTAATGAACCAACCTTAGACTATGACGATGCCAACCTTGAAAATGAAGGACTAATTGTAATCACTTGTCCTTTCCTTAAAAAATACGAAATCTATTTTTATATTCAAAATAGCATATAGTAATTAATATTTAAGAATGATTTTTGA