TTHERM_01284820

Length: 2229 bp

cDNA Sequence

ATGGAACCTGAAAAAAAAAGTTAAGTTAATTCACTTTAAGACATCAACATAACAGTCCCAGACGTTTCAGATAAAGTTAAAACTAAAGCTGAAACTGAAGATAAATCTGGAGTTAAACCTGAAGGTAAATCTGGAGTTAAATCTGGAGTTAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAATCTGGAGTTAAATCTGGAGTTAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAACCTGAAGATAAATCTGAAGATAAACTTGAAGATAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAATCTGGAGTTAAACCTGAAGATAAATCTGGAGTTAAATCTGGAGTTAAATCTGAAGATAAATCTGGAGTTAAATCTGGAGTTAAATCTGGAGTTAAATCTGGAGTTAAAAATGAAAAAAAAGAAAAAGATACAAAAATTTAAAAATCAGATTAAAATAATAAAGATAAAGATGCAAACTAAAATGATTAATAACCAATTTAGCAAGTTTCAAACGAATAGAAAAATAATTAATAAAAAGAAGAAAAAAATGATGTAAAATAGCCATAAGCTGCATAATAATAACCATCATAAATTAATTAGAATTCACCTACCGCATAAGTGAAAGTAGAAACAAATTAATAATCACCATAAAAAAATAGTCCATCTAAACCAGAAGAGAAAGAAGAAGAAGAAAATAAACAATAATCATAAGGTTAAAATAAATAGAATTCGCCTACCGCATAAGAGACAAAAAATTAATAACCATAACCATCATAAATTAATTAGAATCCATCTTAAAAATAAAAAAGAATCAGATCTAGATTTGGATAATAAATCGATGATTAAGAGCCGGATCAAAATTAATCAGATGATAAAATAAATTAAATTAAAAAAAGAATATAATCAATAAAAGATTAAATAAATTAATAAGATTTAAATTCTATAATCGATTCTACATTTAAGTAGTAACTACTCATCAACTAAGTTGTAAATTTATTTTAAATTGAGGAAAAAAATAATCTAATAACCAATGAATAGAAAAAAGAACTTGAAAGTATCAAGAATAATATAAAAAAAATAATTTTACTAAATTATGAAGATTTTTAAATAATAGAAGATTAAATTGGATAAAAATTATAAGACGATAATAATAAAAACTAAAATAATAAACTTGTTTCATAAGCTTATAATCATTTTAATGGGCAATAATAAAATTTGAATTACTTTTTTAATGATTAATAAAATTCTATTAATAAATTAATACAATTTTTGAAATAAAAAACAAAAGAATATGATGACAAAATAAAATAAGAAATAGATCTGGAGATATAATAATAAAAATAAGAAGAATAAAAATTTGATGAAGAGTAAGAAAAATAAAGAAAAGAATTAGAAGAACGTTTATTGTAAAATAATAAGGGTAATATTAATACTAAAAAACTCTAAATTGATTAAGAATAAGAAGAAAAAATACTTAAGGAAATATAAAAAGAAGAAGAATAAAGATAATCTTAAAATAAAATAAATTTTAATAATGTTCCCATATCATAAGAATAATTATAATAATAACTTGGTTAATTATAAAAAGATAACTAAAAAAATACTGATTAAATTGATGATAATCTTTTTATTAAAATTTATGATGATTTTAAACAAAACAACTATGATTTTGAATAATTATAATAAAAAATTGATTAAAATGATTAATATAAAATTAACAATTATAAAAAGAATGTTGAAGAGAATTATAAAAATATAGGTTTATAAGAAGATTCAAAATTTGTTTAAATTTAAGAAAATTGGAATTTATTTGATAAATAATATAGAAATGCTTAAGATATAACAGATTTTACTGAATAAAATTAAATCGAATAAAAACTTTCAAGTTATTTGTAATTTTTGCAAAAGGGATAAACTATTTTGAAAGAAAAAGAAATTGTTGATAATATAGTTAAATAAATTAAAGAAAAAAAAGAAAAAAAAGACAAATAAGATTATTATTCTTAATAATTGTAGTTAATTACTTTTTTAATCTTAGGAAAAGATCATAATCAAATTTAAATTGATGTTTAAAGATTGTTTTTAGAAAAAAATAAATAACATTTGGAAAAAATTAAATAGACATCTGGTTAATAATCTATAGCAGATTTTGGAAAATGA