TTHERM_01289140

Length: 609 bp

cDNA Sequence

ATGAATAATTCGGAAGTTGCTGTTTTAGGAGGTGGTTGTTTTTGGTGTATTTATGCTGTCTTCAAGAGAGTCAAAGGAGTTCAAAAAGTTATTTCTGGTTTTTCTGGAGGTGAGTTGAAGAATCCTACTTACAAAGAGGTTTACACAGGAACAACAGGACATGCTGAAGTAGTTTAGGTTACTTTTGATCCAGAAGTTATTTCTTACGAAAATCTCCTCAGAATCTATTTCAATGTTCATGATCCAACTCTATTAAATAGATAAAATGATGAGGATGTAGGAACTCATTACAGGTCAGTAATTTTTTATTTGAGTGAATAATAACAAAAGACAGCTTTAGCTCTCATTAAAGAGCTTGAAGAATCTAAGTATTACAAAGATCCTATTGTAACTAAAGTTGATAAATTTGAAGAGTTTTACCCAGCTGAAGATTACCATCAAAATTACTTTGATATTAACCCTGAACAAAGATACTGCAAAGCCGTAGTAGAACCTAAATTAAAGAAATTTTTGATTAAATATAAAGACTACTTAAAGCAAGAAGAAGAAGAATTAAAGTAAAAATAATTATAGTAAGAATAATAGTAATAATAATAATCATAGTAATGA