TTHERM_01289180

Length: 837 bp

cDNA Sequence

ATGGAAAAAGGATCTAAGTTTTTGATATTAGGCTCAATAGGATTAGGCATTTTAGGAGGACTTTATATGCTTTTTGGTAAAAATAAAGTCCGTGTAAAACTTTCAAGAGATTAAGTGGTTTTGTTCTTAAAAGATTTAAAGTCATAATCTTAAAGCTAGTTCATAACTACTGCCAAAGTTATTTAAAGAATGATAAGTGAAACTGGGGGTTAGTATAAAAATGAAGTAGAAAACACAGCAGCAGGATATATTAGAAGTGAAGTTTAAGAAATTTTTGATCAAAAAAAGGAAGCAATCTTAATCAAGTATCAAATTGATGAGCAAGATTTAGCTTAAGCCTTAGAATCTGATTTCAAAAATGATGATGAAATAAACAAAATATTAAATGAAATTCATGAAGGTTTCGAAAATAGTTTAAAAGGCATCGAACCTCCAATGAATGTAAAACCAGAAGTGTTTGAAATTCTAACAAAAGACAAAACTTATGACATTGTAAAAAAAATAATGAAATTATCAACTAAGTTATACTTGAAAGTATTCACTGACTTAAAGAAAGAAGGAGAAAAACAAATCAATCTAAAAAACCCTAAATTTTTAAGAAAAATAGGCTAGTTAAATATGAGAGATAGAAAGAATAAATTAATTTTAGATGAAGGAGTTAATCTTGAGCCTGATTCCCCTACTGATATCTTAGGAAAAGTAACCTAAAAATACAAAGACTAAGATATAGAATTTGCTGAAAAACTTATTGAAGTAGATAGATAGTTTACTTATGTAATTGAAAAGCTAGGAGACGAAATTACAACTGAAGAATAAATTGATAAGGCTTTCTAATGA