TTHERM_01308050

Length: 1464 bp

cDNA Sequence

ATGCTTTCAAAGAGCCTCAAGACCGTTTCTAGCTTATTGGTTCCTCGTTACAGCTTTTCTGCTAACTTCAGAACCGAACATGATACTTTCGGTGAAATTAAGGTCCCTGCTCAAAAGTTGTGGGGTGCTCAAACCTAAAGATCTATCCAAAACTTTGAAATCTGTTAAGATGTTGACAAAATGCCTAAATCCGTCATCAGAGCTTTTGGTATTCTTAAGAAGAGTGCTGCTAAGGTCAACCAAAGATACGCACTTGATGTTAAGAAGGCAAGCGCAATCATGGAAGCTGCTGACGAAGTTATTAAGGGTAAGTGGGATGACTAATTCCCTTTGGTTATCTGGTAAACTGGTTCTGGTACTCAAAGCAACATGAATGCCAATGAAGTTATTGCCAACAGAGCTATGGAAATCTTGGGCCAACCTTTCTCTAAGGCTGTTCACCCCAACGATCACGTTAACATGTCCTAATCTTCCAACGATACTTTCCCCTCAGTCATGCATATTGCTGCTGTTATGGAAGTCCACCACACCTTACTTCCTGGTTTGAGAGCTCTCTTAAAGGCTCTTGAAGACAAGCAAGAAGAATTCAAGCATATTATTAAGATTGGTCGTACCCACACTCAAGACGCTACTCCTCTTACTCTTGGTTAAGAATTCTCTGGTTATGTCACCTAAATTAGAAATGCCATCCACAGAATTGAATCCAAGTTACCTGAAATCTCTGAACTCGCTCAAGGTGGTACTGCCGTCGGTACTGGTCTTAACACCTACACCGGATTCGCTGAAGCTATTGCTGAAGAAGTTAGCAGAGAAACTGGTTTCAAATTCACCACTGCTCCCAACAAATTCGAAGCTTTACAATGTAATGATGCTCTTGTTGAATTCTCTGGTGCTCTTAACACCACTGCTTGTGCTCTTATGAAGATCGCTAACGATATCAGATTCTTGGGTTCTGGTCCTAGATCTGGTTTGGGTGAATTGTTATTACCTGAAAATGAACCTGGTAGCTCTATCATGCCTGGTAAGGTTAATCCTACTCAATGTGAATCCTTGACTATGTGCTGCGCTTAAGTCATGGGTAACCACGTTGCTATCTCTGTTGGTGGTTCCAATGGTCACTTTGAATTGAATGTCTTCAGACCCATGATTATCAGAAACATCATTCACTCCGTTAGATTATTGGGTGAAGGTTCTTTATCTTTCACCAAGAACTGTGTTGTTGGTATCAAGGCTGATACTAAGAGAATTGACCACCTTATGCAATAATCTCTCATGCTTGTTACTGCTCTTAATCCTTATATTGGTTACGAAAAGGCTGCTAAGATTGCCAAGAATGCCCACAAGAAGAATCTCACTTTATTGCAATCTGGTCTTGAACTTGGTTACCTCACTGAAGAATAATTCAAGCAATGGGTTAAGCCTGAATAAATGCTTGGTCCTTCTGAATATGTCAAGAAAAACTGA