TTHERM_01354260

Length: 1011 bp

cDNA Sequence

ATGAATAAATTGATCCTTTTGAGTATTATCATGCTCATGCCTCTCTGTTTGGCTCAAAATATAAGTGTAGAAAAACTTCTTGCTTATAATAAATGGTCAAGCTAACATCAAAGAGTTTATCTGAATGAAGATGAAAAACTATTTAGACAAATGGTTTTCTTTGAGAACTTGTAAAAGATTTAGGAACATAACAGTGATCCTAATAACACCTATTCTATCAATTTAAACTAATTCTCAGATATGACTAAAGAAGAATTTGCTGAAAAAATTCTTATGAAATCCGATTTTGTTGACCATTTAATGAAAGGAATCAGTTAAGAGACAACTCATAATGATGCTAATAAAGAAACTTAGTTCAATTCAAAAGGCGTTTCTTATGCTTATTCAATAGACTGGAGAACAAAAGGTGCTGTAACATCGGTTAAGGATTAAGGTAGTTGTGGTTCATGCTGGAGTTTCTCTGCAGCTGGAGTAATGGAGTCATATAACTTCATTAGAAACAAAGCTGCTTTAGTTGATTTTTCTGAGTAATAACTTGTTGATTGTGTCATCCCTGCAAATGGTTACAACTCTTATGGATGTGGTGGAGGATGGCCTGCTTCTTGTCTGGATTATGCCTCCAAAGTAGGTATTACTACCCTAGACAAGTATCCCTATGTTGCAGTTTAGAATAATTGTAATGTGACTGATACAAATAATGGCTTTAAGCCTAAAAACTGGATTTAAGTTGCTAACACGCCTGATGACTTAAAAATGGCTTTGAATTGGACTCCTGTTTCTGTAGTTGTTGATGCTTCCAATTGGGGTAGTTATTACTCTGGAATTTTCAACGGATGTGATTAATCTCATATTAGTCTTAATCATGCTGTGTTAGCTGTTGGTTATGACTTACAAGGAAACTGGATTCTTAAAAATTCTTGGAGCGCCTATTGGGGTGAGAATGGCTATATGAGACTTGCTGCTAACAACACATGCGGTATCTTAAGCTATAATTATTTAGTTACTGCTTGA