TTHERM_01377900

Length: 2028 bp

cDNA Sequence

ATGGATAAAATCAGCTAAAATCCTGTAGGATATTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAACAGGAAAAAAATCAAAGAGATGTACAGAATGAAAGGTATCTAAATGCTCGATAAGGCTGAGTTAGTTTAATCTGTAAAAATAAAACCAAGTCATTTATTTAATAATTTAACCTGCCTCTCTTCGTTCTAATCAAATTTTATCTAAATTTTAACAAAAGTTTCTGATATCTAAGAAACTAAGTTAAAAAAGCCTTTTTTTGCTTACATTTATTAGACAATGAAAAATGAATTAACTGATAAAGGCTACTCTGATTTTAGATTTTTAGGACATGGAGATTATGGATTAGTTCTGTTAGCAAAAGATTCGAAAACTAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGGGATCTTGATGGAAACCTTGAAGAAGATCTTAACAATCAAGTGAAAAAAGAAGTAGAAATACTCAAAAAATGTAGAGAATCTCCTTATGTAGTCAGTCTTATTGATTAATTTGAAGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCAGCTAAATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAATGATATAGCTCAAGGCCTCTACTACATTCACTAAAAGAACTACCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTACCATGGAAATGCAGTTGTTTCTGATTTTGGTTTGGCAGATAACCTAACAAGCAAATCTGGCTATACTATCAATCAATATATGGGAAACTTCTTGTATCAAGCACCAGAGTGTTATGATCCAGCTGAACCATACATAGGTAAGATTTATCATGACGAATATTTAAAATTAGGTGTCTGTGTGAAACAAGAGCCAAGCAACAGACTATTTTTTGATAATTATTTCTTGAGAATAAATTATAATTTAGTATCAAATAAGCACAAAGAATTAATATATGATGATGAATTTTAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGAAGGATTAACTAATTTTGTTCCAAAGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGAGATGCTTATTGAGATGATTGATGGAAACACCCAGCAGTTCACAAATTCACTCACAAATTAAATTGAGTTTGTTAGAGATTTTCCAAATAAGTTTTACCCAATCATGTATATTTATTTGTTTATTCTAATTTACCTCTTTTGTTAAATATTTTAAAGTAAAAACGAACAGACCTTAAACTAAAAGTTAAATGAAGACCATCAAAAAATATAATATGTGAATTAATTAACATATTTCATTCAAAATATCCTCAAATATTCAAAATAATTTGTAAAAAAGGAGGCAGAAATAGAAGAATTATAGAAAAAAAATCTCTAACTAAAATAAAAAATTAATGAATAAGAAAAAAAAATAAAAGATTTATTCATCCAATTATAATAATCTTAAAATCAGTTAATAAATAAACCTTAGAATATGATGATGCCAATGAAGGATGAGTAACATGTTATTTTTGAAGAAGTTAAAAAATAGGAAAACAAAGATGAATTGCCAAAAGAAGAAAACTAAATATTGTAATCACTCGTCCTTTCCATAAAAAAGACTAAATTTACTTTTATATTAAAAATAGCATGTAAAGTTTTTATCACATAATGCTCAAATTAACTTTCATATTCAAAATAGACGCACGTAATTAATTAATATTTTAGAATGATTTTTGATGAGAAAATAAATGCTGAATTAACTAACTTTCATACTCAAAATAGACAAATGATTTTTGATGAGAAAATAAATGCTGAATTCACTTTCATATTCAAAATAGTGGGAAGTAATTAATATTTTGCAATGATTTTTGATGAGAAAAAAAATGCTGAATTAACTTTCATATTTAAAATAGGAGATTGTAATTAATATTTTAGAATGATTTTTGATGGATGA