TTHERM_01444890

Length: 1848 bp

cDNA Sequence

ATGAATACACATAGCTATGATTTAAATGAAAATAACATGAAAATGATCCTCAAAAATGAGCAAAATGAAATTAAACAAATCCTTTCTTAAAAAAAGGAATAGTTTGCTGTTGAGATAAGGAGAAGAAAAAATTAGTGCTAGATTGAGAAAAACAGGTAAATTATAGCCTTGAAATTCAATGAGAACATTCACACCAGATATGAAGAAACAAACGCAGCTCAAATTTATGAGTAAATCGTGAAAGAATATAGCTAATAGAATAATTAGTCAGGTATAGATTCTTCTCCTAGTATACTGTTGACAGATGAAGAATTTTAATTGCATTTAAATAACTTAGAGAACTATACAGGAAATATTTAGTTTTATTGCATTTTGAAGTCACTTATTTACATTAATGCATATTTAAGGATGAATAACATGAGTAGGATTAACATTTCTCAAAAGATGATAGATAATTTAGCTGATATTTCAGTTACTTATGAGAATTAACAGACATCTGAAAATTATTATCTCTCTATAATGGCTTTGTAATCAATTTCTGTGATTTCTTATTTTCCAATCAATGTTGATCTTTTCTCAGAAAAACTATTTAAATCTTTGTTCACTTGGGTTGACTCTAATATGATCCAATTATAATGCAATAGTTTCTAAGCTATTTATTTAGTATCATGCTCAGATGAAAGCATTATGTAGAAGCTTATTGTGTAGTATGATCTATTAAATATTTCTTTAAATGCACTTAAAAACACAATTAGTAGGTTAAAATCGATTGTTTCAAGTAAAAGCTCAAAAAAACTAAACTCCTAAAACAATTTAGAAGAAGTGCTTAGATAGTTGGTGTTGTAAATAATTAGAATAGTTTAAGATTATCAAATATTAACTATGAAAAGTAACAGCAGATTAGATCATTTACATTTTAACGAGTTACTTATTGAAGCAGCTTCTAAAATATTATTAGAGCATAGCGTAGTGGATATTTCTTCTTCTATTATTTGTGGTTAAATAATAAAATTATCTTTAAATTCTGAAATAACCTTTGAAATTACATTGAAAAATATTATTAATTCAAATATCATACCAATATTTTATGAAATAATTGGAAAATATGTCATGAACTACACAGAATCTAAATCATATTAACAATTAGTAGAAACCATAACAAATATCATATGCATAATATCCTCATGTGATGATCAAAATATTTCATAAATTGTTTATCAGTCAAACAGTAATCTAAGTATTCTCATTGACCTCCTAATTAAAGAGAGATCTAAAATAAATATAACTTCTCTTAAAATAATTCATAATATTTGCTTTGATAATCCATTTGCTTAAAACTATGTTATAGAAAGTAATGCCTTTTGGTAGAATTTAGGATTAATAATATCTTATTCAAGTAGTTAAGAATTGGTGAAAGAAATTCTTCTTTTGTTGTTTTAAATGGTAGAGCAAGTAACAAACAACATCGCAAACAAATTTATTGAGTAAAATGGGTTTTAAATTATATACTAAATTTTGTACAAATTTTAAACCCCTCAATTCATAATAATTTCATTTGACATCTTGAACGCCTTGTTCGACTACATCATCGAAGAGAAAATAGACTAAAATCTAGAAAAATTCACTTAATAATGCTCAAAATTTTAAATTATATAATTAGCTGAGAGTTTTTGCTCCAATCATCAAATTTAGAATAACGTTCAAAACTCTATATTTTACTTTTTAAACAAACTTGACACCCATAGTGATTTTCTTAAATCATAAAATAATTTTGCTATAACTGAAAACATTCAATTTAACTCTTTCAAACTCACTCCTGCAAGTTTTGTTTATTAAAATTACAATTGA