TTHERM_01693300

Length: 762 bp

cDNA Sequence

ATGGATACAATCAGCTAAAATCTTGTAGAATCCTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAACAGGAAAAAAGTCAAAGAGATGTACAGAATGAAAGGTGTCTAAATGCTCGATAAGCCGGAATTGAAAGTTATTAATATTTAATTAAATATTAATACTTCTCTTGATTCTAATCAAATTTTATCTTAATTAACTAAAGTTTCTGATATCTAAGAACCTAAGTTATAACCTAAATAAGCTTCAATTTATTATACTATGAAAAATGAGTTAACTAAAAAAGGCTACTCTGATTTTAGGTTTTTAGGGCAGGGAGGATAGGGACTAGTCTTGCTAGTAAAAGATTCTAAAACTAATATTAGGTATGCTATCAAAGGTGTTCAAATAAGAGATCCTTTCGGAAATTTTTATGAAGATGTCAACAATCAAGTGAAACAAGAAGTAGAAATACTCAAAAAATGTAGAGACTCTCCTTACGTAGTCAGTCTTTTAGATTAATTTGAAGGAGAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAAATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATGTCCGCAATCAAATATGCTAATGACATTGCTCAAGGTATCTACTACATTCATTCTCAAAACTGCCTAGTTAATGATCTGAAAATGGATAATATCTTAATTGACTACAATGGGAATGCCGTTGTTTGTAAGTTTTTTACAAATCCAAACAAACTTGATTGA