TTHERM_02031490

Length: 312 bp

cDNA Sequence

ATGCCCTAAATTGCAAAATTTAAAAAAATTTTCTCTATCTAATCTATTGAATTATAATTAACTGCTTTTTTGAGAATGGGAGCAGGATTTAAGACAAGTGAAGAGAGTATGATAGAACTAAAATTGTGTTTGAAAAAGTAGATTCTAGAAGTTTTAGATTATCCTAATTATGAGTATAAGCTAGGATTAGAGGATTAATATAAATAGAAGCTTTCTTAATTTGATGATCTAAAATTTTATCTTGCCATTTTTTATTAAGGAAGCAAATATATTTTAATGGATGTAAATATAGTGAATGAGTTTATAAATTGA