Summary
Transcript IDgene_000000105
Gene IDTTHERM_00011640
Length3438 bp
Sequence
TAGAAAAATAACAATGAAATCAATACTTAAAAATAATAATTAGATTACATTTAGTGAAGAAAACAGAGAAATTAGAGCTAATCTTCTTTCATATCAAGAAAGGTCTGAAGATCATGAGGAGTCAAAAAATAACTAAACTGTTTAAGGCAATAAGACTATATTGTACAATCCTTACAGAAATACAGTAGATACTACTATGATTAATGTAGAAGAGTTTAATAGTTAGAAGCCTTTAGATGTTTATTTAATGACTTCGTTCGATGAAAAAGGCTAATAAAGAAAACCAGGTCTTCTCATATGCAAGCACCCTCATTTAAAATTAGATAAAAGGACCTTGTCAAATTAGAATAACAATAAAGCTCCTAAATATGACAAACAAAAAAAATATTATCCAACATTCGACGAAGAAACTGGTTACTAAGGTCGCTTATTTCCAATCGACACCGAAACAGGCAAACATGGACTCCTTTCTTATTACTCTAAGTAAGTGAAGGGTTTCGATAAGATTAAAATGTTAGTCTGTGTTACAATGTATGCGGAAGAGAGAGCTTTCTTAGAGAATACTTTAAGACACATTTATAATAACATAGAATTTTTTGAAAAGGAAGCTGGTGTTCATCAAAGTCAAATTGCTGTGGTTGTTTTACAAGATGGTATAATGAAAATGAGGTAGGAAACTGTTGATTTTTACTCCCATATAGATGAAAGCTTGAAAAGACCTTGTCATCTTTAAAACCGTAGGAATATAATAGATTAACAAATAAAATTCTTGAAATACACAAAACAAGAAGCAACTCTTGAGTCTAATCAAAATTTCCCTAATACAATTCCTGCAAAAACTACTCTTCTCTATTAAAACCAAATTTAGTTCAATGACTTAAACGAATTAAAGGTTAATTTGGGTGATTAAAATTTTGACCAAAATCACATGGACACAACAAAAAGTGGCTTAATTGTTTTTTCTGCTTTTAAGCATTTGAACTCTAAAAAGCTCTCCTCGCATTTATGGTTTTTTGAAGGTTTTTGCCAATAATTTAAGCCTAAGTATTGTGCATTAGTTGACGTCGGTACACTTCCTGCAAAAGATGGACTAGTTAAATTCTACATGGCCTTAGAAGGAAACGATAAAATTGGAGGAGTTTGTGGATTTTTGGGTTTAGAAGAGCCATAGATTGGTGAAGAAAAAAGTGAAAGAGAAATGATGGCTATCTAAAAAGAAGCTGAAAAAAAAATCAAAGAACAAAAGAGACTAATAAGAGATGAGTGGCAAGACCAAAAAAAAGAGAAAAAATAAAACCAAAAAACTCATATTCAACAAAAAGTAAATTAAGAAGATGACTAAAAATAAAAGTCAGAGGAAATAAGAATAGAAAAACTAAAGAGAATTAAGGATACTAAGAACAAAGTTAATTTAAAGATTCAATTAATTCTATTTCCAATTACTCTTTTATACATCATCTTTAAGAAAATCCTATTTGATTTTATCATCTATAACATTTTTTGGTTTATTTTTAAAATCATTCAATATACTTTACTTGGTTTCTTGCGCTTAGGTAGTTTGAAAAATGCATAACTATATGAGTACACAATTGCTCACATGGTTGATAAAAACTTTGAATCTTTGTTAGGATTCTTGCATGTCTTACCTGGTGCTTGGTCTGCTTATAGATATGAGGCACTACAAGTTAAATTTGAAGGTAGAGAAACTATTTTACAGAAGGCTTACTTCAAATAATTATTAAATCCAAGAAGACTTGAGGGTAATATTTATGAAGCTAATATGTTTTTGGCTGAAGATAGAATTCTCTGTCTAGGTTTGTATTGCCAGCCTCAAAAAGATTATATCTTAAAATATATCCCAGATGCTTATGCTTTTACTGATCCTGTAGGAACATTAGAAGAATTCATGAGTTAAAGAAGACGTTGGATAAATAGTACAAACTATGCCTTGGATTATGTTCTGAAACATTATAGAGGTTTTGTTGAGGATAGTGGTCATACTTCTTTATAGAAAAAGATTATACTTCCTTTTAATATGTTTTTTGCAGCTTTGGGTAAGTTTAATACTTACATGCTTCCAGCTTTCTACATTTTTGTAGCAATTATGTGCAGCTACTAGTTTTTAAATCCTGATCTATAGCAAGGCTACTAGCTTTATGTAGATGAAAATAAAACAGAAAAATGTTAATAAATGGATACATAACCAGATGATTAGATGTGCAATCCTTTAGTAGAACTTAAAAAATAAACTCTTTGCTATTAAATTTGTACAATTAAAGATGATCCATCATTTGCATTAATAGCCTTGAATTTGATTCCTGCAATCTTCATAGTTTGCATTCTATGCATTATATTTGCAAGTTTAGTTTTGAAGGTTAAAGGAGGCAATAAACAACTATATAATAAAATTATAGAATAGAGCTTGGAAGATCATGAGCTTAATGAAATTGGTAGACTTAGAAATGAGCTAGAGCAGAAGTTGTAAGATGAAAGATCTAGAAACGCTGCTGTATAAAAAATAAGAAAAATAGAAATACAATATGAAAAAAAGATACATGACATAAAAGAGAGAAAAGGAAATTATACAATTAGAGAGTTATAAGAAATTAAACAAGAGAGCATTCACACTTTAAAGACAAAGAAATTCGAGCTTAAAAAATTGGTTGACTAACTTAAAACTCAAGAATTTGGTATGACTGTGTTCAAGGTTCTTTCTGCTATCATCTCAGTTAGTTCTTTGCTAATTGCTGGTATTGTTTTAGTAAGCGTAGCACTTAATATTTACAACAGAAAGAACAATGTTATAGTTGGCTTTAAAGAGCTTGATAATACCTTGTACTGGTATATCATAGCTCTTTTGGCTACAAATGTTGCCAGTTATGTGATTATTGCCGTTGTTCATATCTGCCCTCAATACAAACTTGTGTGGTTCATGTTTAAGTCATGGTTTAGTTTCACCATTTATTAGCCTATATACAATCATGTCCTTTTAATCTATGCATTTTGTAATGTTGATGATGTTACATGGGGAACAAAAGGTATCGGCAAAGACTCTGAAAAGACAAACTTTTATTTAAATAAAGTTTAGTTTGTTGGTAAATGGTTATTGTTAAATGCAGTTTTCGTAACACTGCTAATATCAGTCAATTTATTCTTTGCTTAGACTCCCTACGTTATGCTAGGAATAGGTACATATGGTACATCCTATCTTGCTATCAAGAGTATATTGGCAGCAGTTAATTATCTCAGATACTTTTGCTATGAAAAGAAAAAATATTATAAGAAAGTTACTCTTTATAATACTAATTTTGAAAATCCTTCTGCTAAAGCTGCAGCACTCTAAGAATTTGAAGAATTCAGGTTAAGAGGAGGTAGATAATACAGAGAGTCTAATTTATTACAAGATTTAAAGTGAAATCAATCAGTATTTAAAGTAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,883.5 L-21,884.1 L-32,186.4 S-01,579.8 S-32,250.5
S-62,024.7 S-92,467.0 S-122,683.8 S-152,201.9 S-242,035.1
C-02,112.8 C-21,095.4 C-41,809.8 C-62,641.9 C-82,606.4
C-101,028.7 C-121,128.5 C-142,595.2 C-163,170.3 C-183,464.4