Summary
Transcript IDgene_000000135
Gene IDTTHERM_00013290
Length321 bp
Sequence
TTGAAAAAAATTAAAAAAGAAAAATTTAGAAGAGCAAATTATATTAAAAGATAACACATTAAAATAAATGAAGATCAACATTAAGACTTTAAAGGGCACTGATTTTTTTGATGTTAACCTTGAAGAAACTGCTACAGTTGCTGAATTGAAGGAGAAGATTGCTACTGAAAAGTAAAAGGAAAAAGATACTATTAAGTTAGTTCATAAAGGTAAATAATTGACCGAAGACTCTAAGACTCTTGGCGAACTTGGTATTAAAGATAATGATTTTGTTATTCTCATGTTCTTTTAAAAGAAAGCAGAGAAAATTTTATGGCTAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,755.4 L-26,702.9 L-36,417.2 S-011,110.5 S-36,248.2
S-65,150.2 S-94,580.9 S-125,781.9 S-156,039.8 S-247,439.1
C-03,028.7 C-22,439.4 C-44,975.2 C-64,776.2 C-84,392.1
C-106,231.6 C-125,556.6 C-145,661.3 C-166,455.9 C-186,798.0