Summary
Transcript IDgene_000000136
Gene IDTTHERM_00013290
Length1085 bp
Sequence
ATAATTTAAAAAATAATAAACTAAATATAACATTATTATAGAAAGCAGAAAAAGAAGATGCTCCATAATAAGCTTAATCTGATACCACTTCTACTACCTCCGCTGCCTCAACAACTGCTACTAACCCCACTACTGTTCCTAAGCCTGCTGTTTCCTAACCCGCTACAACATAATAAACAGGAAGTTAAGGAACAGGTAGTGATCTCCTTTAAGGTCCTGAATTGGAAGCCAAAATTAAAGAAATTGAATCAATGGGTTTTGAAAGACCTAAGGTTCTTTAAGCTTTGAAGGCCGCTTATTACAATCCTGAAAGAGCAGTTGATTATTTACTCAGTGGTAATATTCCTAAAGAACCTAGTTAATAATAGAGTCCTTTACAAGGCTTACAAGGTCCTGGTGTTGAATAATTAGCTTAATTAGCTTAAAATCCTCAATTCCAACACATTGCTTAAGCTATTCGTTAAAACCCTGCTCTTCTCCAACCTGTCATGTAATAATTAGCTTAAACTAACCCTGATGTTGCCAGACTTTTACAATAAAACCCTCAAGCTTTCTTGCAACTCCTCCTTGCTGCCTCTGAAAACGAAGGTGGATAAACCTTACCTCCAAATGCCATCCAAGTCACTCCTGAAGAAAAAGCTGATATTGATGACATTATTTCTATGGGTTTTGATAAAAATGACGCCTTAGAAGCATATATTACCTGCGACAAGAACAAAGAATTAGCAATTAACTATCTTTTCGAAGCAAGGGAAAGCGGTACTCTTCTTTCTGAACACATCCAAAAGGAAGAATTAGAAGCTGCATAATAATAATCATAAAACTAAAATTAATAACAATAAGGTAATAACCCAAATCAATAATAATAATAAGGTGGATAAGGTGAAGGTGGTGATAATGATGATGAAGATGACGATGATTTTATGTATTAATGATTTATTTTGATAGCACTGTCTTTCTCACTAAATAAAATATTCTAATTGCCTTTATATTTATAAATTGATTGATATTAATTTAATTTAATATTTCTATAAATGACTTAATGTATACATTCAATTATTAAATATCACATTTTAGTTCATTCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-135,661.9 L-239,020.7 L-331,320.1 S-047,309.1 S-334,455.8
S-637,595.2 S-936,012.1 S-1233,929.9 S-1534,660.5 S-2440,113.8
C-025,470.6 C-219,473.6 C-435,236.8 C-631,715.2 C-835,259.4
C-1045,007.2 C-1242,264.3 C-1436,739.9 C-1634,702.4 C-1836,365.0