Summary
Transcript IDgene_000000179
Gene IDTTHERM_00016360
Length1545 bp
Sequence
AATTAAGTTAAATAAAAAGAAAGAAAAACAAAATAAAAAGATTGAAATAATAAAAAAAGAAAAGGAAAGAAGATCGAATCCGCAAATGATTTCAAAAACCTAGGCCTTCGCAAGATTATTCCAATTGAGTTCAAAATCATTCTCTACTGTCAAGGGTGGAAATTTATACACTTGGGGCTAATACGCCAGTGGTACCGGTTTCGAGACCGCCTCTGCTGTCCCCAGAAAGGTTGATTACTTCTCAGGCAATGTCTCCAAGGTTGCTATGGGTCCTTATCACACTGCCGTTATTACCAACGACGGTTCTTTATACACTTTTGGTTGGGGTTAAAACGGTGCTCTCGGTAATGGTGCTAAGGAATTCTAATTATCTCCCAGCCCTGTCAGCTTCTTCAACGATAAGAAACTCAAGGTTAAGGACGTCGTAGTTGGTGAAAGCTACACTATTGCCGTCACTGAAAATGGTGAAGTTTACTCCTGGGGTTATGGTGGTGAACCTTCCAGCAAGATCAACCTTGACTTCTTCAGAAACGCTATTTTACCTCAAAGATGTGGTGCTTTGGGATCTGGAGATAACAAGAATAGATTAACTCCCTAATAAATTGCTAACTTGAAGGCAGACGGATACAAGAATATTTCTGGTGGTGACAACTTTGCTACTTTGGTCAATTAATCTGGTGAAGTTATTAACTGGGGTACTGGTCTTTTCGGTTCTTTGGGTAACGGAAGCGACTATCCTTTATTCACTCCTGAAGTTAACGCTTACTTCAAGCACTTGAAGGAACACGAAGGACTCACTGTTTAATCCATTAAATCTGCTGGTCACTTCTCTGCTGCCTTATTATCTAACGGTAAATTATACACTTTCGGTGTTAACACTCAAGGCTAATTAGGTATCCGTGAAAACCTTGGTCACAACACTGACTAAAATGCTCGTCTCCCTACCCCTGTTGTTGACAGACACTTTGTTGGTCAAAAGGTTGTTGACTTCGAAGTTGGTGAGAACACCCTCGTCTTCCTTACTGATAAAAACGAAGTCTTCTTCAGTGGTTTGGAATTAGCTTATTAACCCATCAGATGGGAAATCCCTACTGACAAGAAGATTGTCAAGCTTGCTGCCTCTAAGGACACTTTTGCTGCCGTCACTGAAACTGGTAAAATTTATTAATTCAACGAATTCGTTGGTGTCTCCACTAATGAAGTTGGTAACGATTACAATGTTGCTGATAGCAAGGCTTTCGAAGGCAAGGTTGTTGATCTTGGTGGTTCTTATGGTATTAGATTTGCTATTGTCAACTGAAAAACCTAATGAAGAATTTGATTATTTCACCAACTCCAATTAGCTAATATTGAAGTTGGTTTCTAAGAAGCAACAAACAAACAAATTTCACTAAAACATAAATTATTAAATCGCTATTTCGAATATTTTTTCTCATTTCAATCTATGTTTATTAAGAAAAAATGATCAATTAAATTATTCAAAATAGCATTTTCATATTTGTTTTTGTATCTTTATTACAAATTTAAAAGGAAACTTAATAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-144,876.8 L-246,837.9 L-350,438.1 S-047,175.8 S-337,114.5
S-624,882.6 S-924,741.8 S-1221,405.1 S-1521,549.5 S-2417,876.7
C-011,934.8 C-219,190.2 C-418,832.4 C-69,591.7 C-816,173.9
C-1015,999.1 C-1223,762.3 C-1420,365.6 C-1618,589.8 C-1814,899.5