Summary
Transcript IDgene_000000212
Gene IDTTHERM_00024260
Length1128 bp
Sequence
ATAAATTTTATAAAATATGAATAGCACTAAGACTTTGCATGACTCTGTTCAACTAGGTGAACTAAAGCTCTAAAATAGATTTGTTGTAGCTCCTTTGACTAGATAAAGAGCTGATAAAGATTCTTTTATCCCAAACGATGTAATGAAAGAATATTATACTTAAAGAGCATCTTTCGGTCTGATTATTACAGAATGCTCCTAAGTTTCTAAGTTGTCTGATGTTTTTTATTGGAGTGGTGGAATATACAGCAAAGAATAAGCTTTAGGTTGGAAAAAGGTAGTTGATTCAGTTCATGAAAAAGGCGGATTAATCATGCTCTAAATTTGGCATTGTGGAAGATCTGCAAATATAAGCTAATTAGGTGGAAAGCAACCTATTGCTCCATCTCCTATAGCTATTAACTATAAAAGCAGAGCAACTGGAGAAGACTATCCTGTACCTCATGAGCTCACAATTGAAGAAATTAAAGAAGTCGTCTAATAATTTAAGCAAGGAGCAATTTATGCTAAAGAAGCAGGATTTGATGGAATCGAATTGCATGGAGCAAATGGTTATTTGGTTGATTAATTTTTGAGAGATGGCTCAAATAAGCGTACTGATATTTATGGAGGAAGTCCTGAAAACAGATCTAGATTCTGCCTAGAAGTTATAGATGCTCTAGCTGAAGTTTTTGGCTATGGTCGCACAGCATTAAGAATATCCCCAACTGGTAGATTTAATGATATGTATGACTCAGATCCAGTAGGACTACTCAGTTATTTACTTCCTGAATTAGATAAAAGAAATCTTGCTTTTGTTGAGTTCAAGAGGCATGGAGCTCTTGAAAATAGAGCTGTAGTTTATCCAGATAGAAAAACTCCTTAGGAATAAATGCCAGATTTCTTCAGAATAATTAGAAAATTATATAAAGGAAATATAATTGCAAATGATAATCTTTCGATTGAAGAAGCTTAAGAATTAGTTTAAGAAGAGGTTGCTCAAGCTTGCTCTTTTGGATATAAATCAATCAATAATCCTGATCTACCACTCAGAGTCAAAAATGGCTGGAAGTTAAATGAAAATCTTGATAGAGATACTCTTTTTACTTAAGGTCCTAAGGGTTATACAGATTATCCATTCCATAATTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,749.6 L-24,661.3 L-33,212.9 S-0690.6 S-3227.0
S-6184.9 S-9203.0 S-12134.0 S-15120.1 S-2468.3
C-0314.9 C-2114.4 C-4222.4 C-6152.3 C-8254.1
C-1093.1 C-12101.9 C-14130.3 C-16130.3 C-18125.4