Summary
Transcript IDgene_000000215
Gene IDTTHERM_00024330
Length553 bp
Sequence
AAAAAATTAAATACCTATCCATTATTTAAGAAGAATTTACAACTATTAAGCAATGAGTTTATTTCCTTCAAACATTTTGAAAGCTGCTAAGAAATCTAAAGTGATGGTAGAGCTGAAGAGCGGTGATACTTATATTGGAGTTTTAGAGGATGTAGATAGATTTATGAATATACAATTAACTGAAGTGACATTTACTTCTAAAGATAGTCAGAAATTTATGAATATTGATCAAATATATATTAAAGGTGCTTCTCTTAAATATTTTTAAATGGATGAGGCCGTCATTGACAAGGCTATTGAAGAATAAGAAATATTAAATGAATAAAAAGAAGAGGCTAAGAATAAAATGAAGCAAAAGAAGGAGGGAGCTGCAACACAAGAAAAGGATGGAAAGCAAAATAAAAAGTTCGAAAAAAGTAGAGGAGGTTATAAGGGAAAGTCTAAGCCAAGAGGTTCATGAACTTAAATTAAATTAAAAATAAATAAATAAATTTAGAAGAAATTATTTTAATAAATTAAAAATATTAATTATTAGAAATTAACAAAATGTTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,644.7 L-21,236.5 L-31,250.4 S-0481.9 S-3251.0
S-6339.7 S-9265.3 S-12262.1 S-15367.7 S-24305.9
C-0415.3 C-2769.4 C-4166.2 C-6871.2 C-8739.2
C-10508.4 C-12223.7 C-14161.5 C-16274.1 C-18211.5