Summary
Transcript IDgene_000000245
Gene IDTTHERM_00675720
Length1917 bp
Sequence
AAGAAAGTTTAACAATTTATTCAATCAGTATATGACAAGAAACTTTGCTTAAAAGCAATACTACGATTACGAAAAGGTTTTAAGATATGTAAAGAAATTCATAGCAGCTCCTCCAATTGTTTTAAATCCCATAATCGTTAAACTAATTGGATAAACATATCAAACTGTCAACCCCAATAACATTTCTGAAATTGTACCCTTCCTTTATTTCCTCTCAAAGACTGTCCAAAATTTCAAAGTACCTTACGAAAGTTAATAGGTGATTGAAAAGAATTTGCAATAAGAGAAAAATATAATTATGCTTAGTAAGTTGATGGAGATTTATGCTACTACTCATTATTCAAATGATTAAAATATTTAAGATTTAGAGTAGAGAATCATTTAGCTTAGTAGTTACAGTGCTAACCCTACTTCTCCTTTGCTGATTTTGTTTTAATCATTAGCAAACATGCATAGAGGTTAGACTCAATCTCTTCGTTATATTGTTGACTACTTTAAATATCCTGGAGTGCTCGATAAAATTGAATTCTTTGATTTGATTGTTAAGTTTATTCCTTCTTTAGCTATTAAAACAAAAGAGCTTTACAAATTTGCAACTAATATGGGATTTTAATCTTAAACCAACTTAATAGATGACACAAACAGAATAGATTTAGATTTCTAAAACAGTTTGGAATAATTATGGGATAAGGTTGAATCTTTAGTCATTTCAAGGATAGATGAAATTTATTACGATAAATACCCTACTCTTTTATTACATTTTATGTATGCAAACTTAATGAAGAACAAGTATAAGCGCATATTTTTCATTCTACAATAAAGAGTTACTCAGTATTTAGACAAGTATACTCCTAAATAAGTTAGTGAGATAATTTATTCCTATGCAAGAATGCATGAAAAAAACAATGAGTTATTCTTTAAATCAATACCAATTATTTTAAAGAACATAGATTAATTCAACACTATCGAATTAATCAATATTTATTGGGGATATGCTAATGTGCGTATATATGATAACTAGCTTTGCACTGCATTAGAAGAAAGCATTATGAAAGAATAAACTAAGGTTAATCCTGAAGGATATATTCAATTTTTCCATGCCATAGGTATTTTCAGTAGACAAATAAATTCTGGTTCTAAGTTAGACGAGTTTATTCGCTCTAAGATATACAATCTAGATTAGTTGAAGATAAACGTTCAACAACAATTTGCTTTGGCCTATGCTATTTTGCTCTTCAACAACAGAAGCTAATATTCTCTCTTTTGGGAAAATATAATCAACCTAATCTTGTAAAACCAATCCAATTTCATATCAAGTCCTCTATACATGAATTATTTGTATCAAATCTACATACATCTTAGATACTCTGACTCAATATTCTTACCCTGTATGTAGATTCTTCTCTAAGTGTTAATTAAAAATAGAGATTCACTTATCCGTTTTTACAAAGTCAATAAAAGATACACTAGCTCCGATCTTGAGAAAAAAATTACCTAAGTAATTGATGAAAAAATAGCTGCTCCTTAAAATGACCAAAAAGTCTTTGTAGTCTAAATCAAAAATGATATTCCATTAATTTTCTATGATGACTTAAGAGAGCTGGAGTAAAATCCTAAATTCCCTGAACATGAATTGATAATACCTTATACTCTGGATTGTAGAAAGGGTGCTTTATGTTTCGAAGTAAATGGACCATAACATTATTTGAGTGATATATAAAATTAATCTAGTCTTGATGGCGTTACATTGCTTAAGAAAAATTTCCTTGAGTAACTCGGCTTTAAGTATATTGAAATAAAATACACAGAATTTGTTCCTGGTATAGTAAAAGAAGACAGCTTGCTTACTTAAAAAGTAATGGATATTGTAAAAGAATAAATGAAAGACGTTAACACAAAAAAAGTTTAGTAATGAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,090.5 L-2978.3 L-3916.6 S-0160.6 S-337.9
S-638.1 S-938.2 S-1240.4 S-1542.6 S-2447.5
C-033.6 C-256.1 C-449.1 C-639.4 C-878.5
C-1079.4 C-1259.8 C-1463.4 C-1647.2 C-1846.1