Summary
Transcript IDgene_000000284
Gene IDTTHERM_00703410
Length875 bp
Sequence
AATAAATCAAATCTTACAAAATAAAAAAAAAAGTTTAGTAGAAATGTTCAAAACTCTTGACGATTTAAAAGGAAAGAAAGACGATAAGAAAGATAATAAAAAAACTAATTCATATGCAGGAGGTGAAAAAAGTGGACTTGCAGTTGAAAATCCAGATGACATTAATGGTATTATTGAAAAGGCTGAAAAAAATACAACTTCAGATGAAGGTAAAGGAGGTAAAAGCAGAAACGATGAAGTGAAATGCAAAATTACTCTCTACCAAAATGGTTTTTGTATTGATGATGGAGAATTCAGAGACTATAATGCCCCTGAAAATAAGCAATTTATGAAAGAACTTAATTAATAGATTGTCCCAATGGAACTTAGAAAGAAGTATCCCCAAGGAGGACTTTCAGTAAGTCTAGAGGATAAAAGGTCTGAAGCATATAGACCACCAACTCCACCCAAATATGTAGCATTTTCAGGATAAGGTTAATCTCTTGGCGGAGCAAGCACATAATCTCAAGCCTTAGAGGTTAACTTGAAGAACGGAGAAATTATAGTTGATGAAACTAAGCCCGTCACCAATATTTAAATTAGATTGCATAATGGTAAAACAGTTAAGATCAAAATTAACACTTCTAGCAAAGTGAGCGTTCTTTATGACTATGTTACTTAAATCGCTCCTGTTGATGGAAGTTTTGAATTAATTAGCGGTTTCCCTCCTAGACCTCTCACCTAATTTAACCAAACTATTTAAGAAGCTGATTTGTTAGATTCAAGAGTTACTTAAAAAATAGTTCATTGATAAATTAAATTAAATTAAATTGTATTTATTCATAAGTAAAGTGAGTATTCTAAATGAAATTTGGTTTGTTAAATATCCAAAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-17,427.2 L-210,347.4 L-37,626.5 S-014,320.2 S-39,945.0
S-611,067.3 S-99,685.8 S-1210,548.1 S-159,928.9 S-249,675.7
C-07,555.5 C-211,591.5 C-410,620.1 C-68,812.1 C-87,707.6
C-106,946.6 C-127,188.8 C-147,388.3 C-166,898.6 C-188,816.8