Summary
Transcript IDgene_000000285
Gene IDTTHERM_00703410
Length1618 bp
Sequence
GAATTTTTCTAAAACTTCGAAGTCAGTTTGATAAATTATGGTAAGGCTTGTGAAGTATGCGAAGATAATTTAGGATCTAATCATAGATTAACTCGTCGCTTTAAAGAGCTATTTTAAAAATTTAATGAAAAATTAGTTAAATCAGAGAAAAAGTCAGCTTTAGTGCCAAAAAATCACAGGAAACTTATAAGACCTTCATCATCTCAAAAAAATATGCTAGCAAAGAATAGAAGCTTTCAAAACGTATCTTCGTATAGCAATGAGAATAATGGAGGAGAAAAAGATTAAAAGAATACTTAATTTATTCAAAGTAAAGTTAATCCTTATAGGCTTTCTTATGGGGTTAAGCCTACAGACTTTACTCAACATGGCAAAATTGTTTATTACAAAAATACCAATAATTCCTAATAATAAACAAGAACGTCTTCAGCAAATAAAATAAATGCTTCTAAAATGAGTAGGCCAAACAGCTCTAAAAGCATCTATCCTGAAATTAAATAAAATTTTCATCAAATTAGCCGTCCTTTGAGTGCAAAATTTTAAAACACACCAAATGGTGGATTCTTTGCTAATTCTTTAACTCCAAAAATTAATTCATAATCAGGGGGTCTTAGTAGACCATTTTCAGCTCAAACTACTAAAAGCAATTAGATTGCTTTCAGCTAAAATAAGGCTCCAGTTAAATCAAATTTAAGCAGGCCTTAAAATAAAAATAAAAAATAAACTAGAGATTCTTCTAAAGACAAAGAAGATGGTAATTAGAATATTTATGATTGGGTTGACTCTCCCACAAACTCTAGTGCTTCAGGAGGAACAAACAAAAAAGTTTTAGATAACTAAAAAGACTTCTTAAAAAGTATAAAGAGTGAAGCTGAAACATAAATTCAGAAATTATAGTAAGAGGAGGCAGAATTGAAAGAGCGTATTTAAAAGCTAAAGTAAGATGAAGAGGAAGAATCAAAATAGAGATAGCAAAGACTTTAAGAACAGAAAAAAAAAGAAGAAGAAGATGCAGCTAGAATAAAATAAAATTTAATTCTTGAAGAAGAAACAGAGAAAAAGAGGATAGAAGAGTTATAAAATAAAAAGAAAAAAGAGTAATAAGAATTAGAAAGGATATAAAATGAATATAAAAAGTAAAAAGAGGAAGAGTTAGAAAGAATAGCCAAGCTAAAAGAAATTAAGAAGTAATAAGAGGAAGAAATTGAAAAACTGAGATTGCAAAGAGCTAGAGAAGAAGAAGAAAAATAAAAAAAGCTTTAAGAGCTTGAAAATATTAAGAATGAAGAAGAAAACAGGTTGAAAAAATTAAAAGAGAGCATAGGTAATGAGGATACTAATAAAACTAACCTTAATAATAATTAAAATGCTAAATTTGAGGAGGAAGAAAGAATTAAGAGAGAAAAAGAAGAAATACTCAAAAAATTACAGTTAGAAAAAGCAGAAAAAGAAAGGCTCTAATAAGAGTATGAAAAAGTCAAAAAGGAGTAAGAAGAATAAAAAAGAATAGTTAATGAAAATTTGCTGCTCAAGTAAGAGAAAGATAAATTACTTGAAGAAATTTAGAAACTTTAAAATTAAAAGTAGTTTTAAGTTTAAAAGACAAACTAATAAACAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1519.0 L-2582.0 L-3410.1 S-0439.5 S-3349.8
S-6265.3 S-9244.3 S-12259.5 S-15185.9 S-24305.9
C-0683.6 C-2249.4 C-4142.0 C-6722.6 C-8627.8
C-10412.2 C-12333.2 C-14308.8 C-16335.7 C-18312.1