Summary
Transcript IDgene_000000286
Gene IDTTHERM_00703410
Length1096 bp
Sequence
TAGTAGTAAGGATAAGTTTATCAAAACTAACAATTCTAGGGTTAATAACTATAATACAGTAATAAAGCTTAGAATTTTCAATAATAAAATATGAATGCTGCTATGAATCAATATGAAAATTATCACCCTTCATAGCAACCTCAAATAGAAGAAGAATCTTATGATTCTTCAAATGTAAATAATTATACAGGAGATTAGTATTAAGCCTAATAGCAAAAGGAATATTAATAAGCACAGATTTAGAATTATTATAAAAATTCGAATTAGATGTAGCAATAGCATTAAAATTTTTTTTAGGATGAGCATACAGATGGCTACTTTGATTAAAGCAACAACCCCTCAGGTTAATTTTATAATCAAACATAAATGAATTAGTAAAATTAAATGAATCCGATTTCAAATAATAAACAAAACTAAATTTACTACAATGACATGTACTCAGATGGAAATAAACGAGATGATATTGTATCTCCAGACGATTCCCTTGCTTCTGATATAAATGATAATTAGCCATTCGAGGGCTATGAAGATTTGCAAAAAGATTTCAAAGAGGATAGAGTAAATGAAGCTTTGGATGTTTGCGAATAAATGATCATTAATCAACAAAAAGTTAGAGGGCCTGCTTCCTTTATGAGACTCTTTTAGCAAATATTAAAGTTTTTGAATAATGAAGCTGTTAACAGCTTGAATTAAAACTAATTTGAAAAGTCTCTATTCATTTTAATTAAAAGTAAAGAGTTAACAGAGCTCAGTATTATCAAAAATCCCCCTTCAATTCGTGCTTTAACATTTAATAATTTTGGATGTTACTATCGAAGACTTTAACAGCTACCAAAAGCTCTAGGCTATTTAGAATAAGCCCTACGATTCTTAAACTCTATTAAATCTAGGGATTATCTAGGTATGACATATCTTAACATATCAGCTGTACTTTCACAGATGAATGAACATTATGCTTCATTAGAAAACGCCAAAAAAGCAGTAATTGAAATTCATAAGGATTACTAAAACTATTTAAATAGAAAGAATTATCAAGAAGCCATAAAAGACTAAGAATTTGTAGATATTTGCCAAGCTCTTGCAATTGCTTTTTACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1652.6 L-2536.7 L-3455.5 S-0431.6 S-3328.2
S-6201.2 S-9196.5 S-12228.5 S-15256.3 S-24275.2
C-0740.7 C-2196.0 C-4169.8 C-6649.9 C-8546.5
C-10398.0 C-12349.9 C-14218.8 C-16279.3 C-18323.3