Summary
Transcript IDgene_000000325
Gene IDTTHERM_00711780
Length1113 bp
Sequence
TTTAAACTATAAAAGGGATTAAGAATTTAAATTAGGAAAATCATATATTTCAAGCAATGTCATCAACTACTTCTAACTAAGCAGCTGTTTAAAACCACGTTGCTATAACAGAAGCCCTATAGCAAAAAAATAATATTTAAAAGGACGGAATTAAAATTGATTATAAGCACTCAGCCTTTGTTGAGTTTTGTAAATATATGACAGGTCCTGCAGTAGTTTAAGCAGTTAATAAGACAATTTTCGCTCCTTTAGAAAGAATGAAGATCATACATCAAGCTTAAAATGCTCTCTATATAAATGAAAAAGCTAAATTTAAGAATTTCTTCTAATTCCTTTAGAGAATACCTACTGAGCAAGGTATTAAGGCTTACTGGAGAGGAAATTTTGCCAATATTATGTACATTATACCCCGTACTATAGCATAGTTTGCATTCTTTGAAAATATTAATCACTTTTTCTTCCCTGCAGGTGAAAAGAATATAACCGAGTTAGAATACGCTTTAAGAAAATTTAGTGCAGCTTTAACTGCAGGTTTTTGCACTCTTTCATTAGCATACCCATTTGATTTAGCTAAAACAAGATTATCATTAGAATTTGCAAAAAATAAATATGATAAGTAGTTCACTGGTGTTTTGAGTGCTTTAGGAGAAACTAGAAGAAGAGGTGGTTTCACTGGATTATATAAAGGCTTTTGGCTTGCTAACTTCACCAATATTCCTTATTATTTAACCCTCTTTACAAATTTATAGATTTTCAAATCCATGAATTAAAGTGAAGTCTCTAATTCAGAGCTATTTTAATATTTAGCTCCTGCTTCTATTGCTGGCTTAGTCAGCACTCTTGTTGTATATCCTTTAGACACCGTCAAGAGAAGACTTTAAATTAATGGATATAATGGAAATTTCATGTATAAAGGAACTTGGGATTGTTTCAAGAAGATTTGGGATAAGGAAGGTGCTTTAAGCTTATATAGAGGAATAACTATTACTTCAGTTAAATTTTTAGGAAGTGCTGCTCTTTAAACTATTCTTGTTGCTTATTATTCTTAACTTAAAAAATAATACTCATTATTTTGAAACTTTAAATTAATTTGATGAGAAAAATTGTTTATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,747.9 L-22,603.2 L-32,667.3 S-0752.8 S-3141.7
S-698.1 S-9160.3 S-12162.7 S-15213.4 S-24196.8
C-0117.7 C-2156.6 C-4180.7 C-6144.7 C-8344.7
C-10184.3 C-12234.6 C-14199.5 C-16135.8 C-18150.7