Summary
Transcript IDgene_000000388
Gene IDTTHERM_00721790
Length1678 bp
Sequence
AAAAAAGTCTTATTTGATAATTAATAAATAAATAGTAAAAGGCACACAATGTTCAGAAGAATAATTTCAAATGGTGCTTTATTGAGCACTTAAACCCAAAGATGGTAAGACTTATCTAAATTCGCTTGCCTTAGAGCTTCTCTTAACAAGGAATCCGAAAAGGCTTTCTAAGAGCTTGCTAAAAAGAACAACGTTTCACCCTAAGAATTAGTTGAACTTAGCAAGATTGTCTCTATGAATTTAGACGTCCTTAAGCAAAACATTAACTCTGAGTAATTCCTTTTAGAAAAGGAATCTACTCTCAAGAGATACAGATAATCCAGCATTGGTACCAGAGGTCATCTCCAAACTGTCAATGAAGCTGTTAACACCAAATACCCTACTTTGGCTGAAGGATTAGGTCAAGTCGCTGGTTACAAGGAAGCTTACTAAGCTTTAAGAGAAATCTTTGTTCATCCTTCTATTTCTGTCAATAACTTAAGATAAGGTTCTTATGGTCAATAATTTGCTGTTGATTTCAGAACTAGAGCTGATGAATACGTTAAGGCCCTCTTAAAGGATCACTCCAGCAACCCTCAAGCTGTCTAAACCATATAAGAAATTCAACACACTCTTCATTAAATTATTAAAAACTACGAATAAAATCCTGCTTCTATTTATGCACGTATTTTGACTGTCCTCTAAACCAGAGGTGTCAACACTTTACCCGTCTCCAAAACTGCTGACTAAAAGGCTGTTGCTACTATCCAAAAAACTTCAACTCCTTCTCTTACCATTGACTAATTGACTGTCCCTGTTTAGGAAAGAGTTTAAACTTAAACTGTCTTTGATGCCGAATTAGCCTTCATTAAGGAAGCTAATGAAATGATTCAACAAAATACTGGTAACTTACCTTGGGATGGTGGCAAAAAGAAAATCTTCTAAGGTTAAGCCAATAAGTACTTAGAAACTCCCTACTACTTACTTGCCGCTCTTTCTGGTTTGGGATTACTTTACTTCTTATACAGTGGTGACGCTAAATACAAAACCTTAGTTTTGACTCCTGTTGTTGGTATTGCTGCCTTCGTTTTATTAAGAAGAAACTAAATTTTAAATAGAGTCCCTACTTTAACTGAATTATTCTTACATAAGGACGGTAAGTTTGTTGATGCTGTTGTTTCTGTCAATGGATAATTGATTAGCAAGAACGACATTCCAGTTTCTACTCTTAAATTATACAGAGGTGACCACACTGTTAAGGTTAACTTAAATGACTTCGAAGATGCTTCTGCCAAGAAGTTCTTAGCTTAATAATCAGGATAAGAAGGAGTCATTAACGTTCACTTCTCTAAACTTAGAAATTTGGCTGCTAGAAACGGTTAGGTTTTGAATTTGGGAGATACTGAAGTTGTTGTTCCTTTCGAAAACTAAGCAAATAGAATCATCTTAAAGCAAATCTTCAAGGGAGTTGAAGTTCTTCCTTCTTCTTGATTGACTAATCTAACTTTCTATCTATATTTTTGGCCAGCTAATTTTAATAAAAATTATTGAGTTTAACTAATATTTCAAACTATTAAAAACTCGTTATTTTACTTATTCCCAGTGTATTATCTTGGAATATTTTATAATCTTCAACAAAAATTCAATCAAAAATTTATTTTTTTCCAGCTTTCTTGTTAATTTATAACTAAATCTGTCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-134,455.2 L-236,470.1 L-333,823.1 S-030,168.9 S-324,568.3
S-615,382.1 S-915,892.2 S-1213,568.7 S-1512,581.2 S-2410,582.4
C-07,774.9 C-215,862.9 C-429,460.7 C-625,988.6 C-815,847.8
C-1013,861.5 C-1211,713.3 C-1414,728.8 C-1613,988.2 C-1811,263.7