Summary
Transcript IDgene_000000449
Gene IDTTHERM_00732770
Length2352 bp
Sequence
ATTAATTGTAAAGAAAGAAAAACTAAATATCTAATTAATCAATTTCTAATAATTAAATATAGATAACTAAGTATATAAAACATATTTAAAAAGTTCGCTTCAACACCATTTCCAACTATGTCTTATTCTAAATAATTTTCAGTTAACGAATTCTTTAAACTATCCCTTGAATAGTATTTATTAGTAAAATGCTCACTTGTAAAATTGGCTCTAGATGAGGCTCAAAAAAATGAGGAAAAGAAGCAAATTATATTAGATTATATCAATGATTTCATAGGCTTTAGTAAACATGTTTTAGGAAAAAATTGTAAAAACCCGTAAATTTTAATCGCTGAAATCTTAGAAAAATTATTGATAGTAGACATCTAATTATTGAGAAAGAAAGAAGATGAATTCCCTAGAGATATAATTAATAGATAATTTAAATTAAATCTTCTTTAATTTGAGAGAATGGACTTGCACATTATCTAATTATTTACGCGCCTTTAGTGTTTAAAGCTCATGTATGAGTATTTAACAGTAGCTGAAAAGGTTCCTAAGGGATTTAACTATCGTGAAAAGTTCGATAGTGATTTAGTTAAGCATATTGATCAAATAAAAGTTTATATTAAAATGAATTTTAATAATTCTAATGAAGGAGATGCTCATATTATTAAGATATTTAAAATTCTATTACTAAACTGTACTTGCATAGAGTTCTACACCTTTTTGCATAATTTTACTATAAGATAAGACCTCAGTAAGGAAGTTAAAAAATTTGTTAGACAGGAATATGAAAATTTAAGACAAAAGTATTGTGAGAAATAAATTTAGTACCAAAATTAAAAGATGCTTCAATCGCTAAATGATGAACACTCAAAATCACAAGTATAAGTGCAAAATTAATTATTTAATAGCAACAATAATTCAAATCCTTCTTAATTAGTTTTTCTTGAGGGAAATTCTCAAGGTAGTGAAAATTTTTGCAATATCGGAGATGAGAATAAAAAAAACAATAATAATAATAACTAACGCCAGCGCAGGCAATTTAATGCCATTTTTATTGGTAATAAAAGCAACAATCAAAATTAGCAATTATAGTAGGAATTGCTAAATGATAATAAGATTGTGCTATAAAATAAACTTTAATCAAAATCTTAATATTTTTCTTCAATGAATTGTGAAAATTCTGTCAATAGATTGATGGAAGAAGAAAATTCTGTCAATTAATCAATTCATTACTAATCTGAAAACAAAAGTCTTATATAGAATGATAATAAAAATGGAGAGTACTAGAGTCGTGTGACTCACTCAGAAGAAAATACTTAGTTCAATTTAATTAATTTTAAAGGATTGATAAATAATATTAAGAGTTAGGATTAAGGTGATAAAATGACAGAACCAAACACTGAATGCAAATTAAATAAATAAAAATTTATTAGCGTTAACAACTCATTTTATTCAAAAATAAATCCAAATGAGAATTTTAAAGAAGAAAAGAAAGCATCATTAAATATTTAGTAATCATTAAGTGATGAGACAATCAAATAAAATGACTTACAATTGAAAAATTTAAATTCTGTTAATGATAGTAATAATAATACTTTCTTACAATATAATAATGAATCTGAAGATAACATTGAAATTGCAAGAAGAGTCAGTTCTTCTAGCTGCTAAAATGGCTCTAAAATATCTAATTCTTCAAACTTGATAGGCTCTATTATCAACATTAATAATTAAAAAAATATACCTGCTAGCAACTAGCGTTAGCTATCGAAACCTATTTAGAGTGGTAGAACTATTTACCATGCTTAAAATAAAAAAATATAAAGAAATTCATAAATAAAAAGTAATAATCCTAGTTCAAAACTTCTAAGAAGTAGCTCCAAAAATAACACAATTGATAGTAACAGCAATAATTAAAATGACATTATCTCGAAAGCAGCCAAAATACTCATGTAAGAGCAGGATTAAAAGAAATCAGCTAAGCTAAAAGTGATGAGCAGAGAATCTAAAAAATATCAGTAAAGTGAGAGTTTCGGGTAATCTGCTGCAAAAACATACAAAGCACCTTCTTCTCAGGAGAACTTTTTAGAAGGATTCCAAAATATAAATAACAACAACAACACCACCCATCATTAGTACCAAAGTGAAGACGAAAATTCATTACCCTTAAATTATATGTGGGGTCATAACTGAACTGAACTAAACAAACACAAAAATATATATCTTACTCAAATTAATATTTAATATAAATTTATTTTTCCCTCTCTAATTATCTATCTATCTATCTACTTTATAAAAATTGTAGTATTTTATTTATCATATTAAAATTGGTTAGTAATTAATTTATTAGGTTATAGATTTTTCTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1425.1 L-2290.0 L-3342.6 S-0151.0 S-3184.2
S-6130.2 S-9139.3 S-12118.2 S-15119.8 S-24107.2
C-0182.7 C-25,722.3 C-48,491.3 C-613,248.4 C-88,491.5
C-102,962.0 C-121,183.1 C-141,993.3 C-162,205.5 C-181,215.6