Summary
Transcript IDgene_000000491
Gene IDTTHERM_00752220
Length728 bp
Sequence
GTAATACTAAAACTAATGAAATCGTCTAATTAGACTCAGATTTATAAATCTGATTTTCAAATTCTAAAAGAGCATCATAAATTCCTTAGAGATGATGAAAAAGATAGCCAAATTTAATACAGTAATCCCACTCAGGAGTAATATGGCGAGATATTAGCAAAAAAGTACTATGAAAAGCTTTATAAAGAGTATGCAATCATTGATTTATCTAGATATGAAACAGGATAGATAGGCATGAGATGGCAGACTAAAGATGAAGTTATCATTGGTAAAGGAATTGTCATCTGCTCAAATAAAAAATGCACCAACACTCAAAATTTGGACAGTTATGAAGTTAACTTTGCTTATGTTGAAGATAATGAAAAAAAAAATGCTCTAGTCAAGGTGAGGGTCTGCCAAGAATGTGTGCTTAAACTGAATTATAAAAAATAACACCAAAAAGTAGAAGATAAAAATTTTGAGCATTCCAGTCTTACAAATTAATAGCAGTAGCCTAATCAAAACAATGAATAATCTGGTAATTTAAAACAGCTGAATGAAGTGCAATAAAATAATCAGCATGATAAAAAACAAAAAAAAACTGAAAATGATCATTTAGATGTCCAAAGAAAAATTAAAAAAGATAAAAAGAAGAAGAAGAAACACAAACATTCTAAAAATGATGATGAAGATGAATGAATTAATTAATTAAATCTGTATTTTTAATCGTCAAAAAATATATATTATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1916.8 L-2667.8 L-3342.1 S-0642.5 S-3311.0
S-6362.0 S-9315.6 S-12266.1 S-15292.8 S-24284.5
C-0317.8 C-2278.2 C-4228.7 C-6592.3 C-8309.9
C-10388.7 C-12276.7 C-14280.2 C-16225.3 C-18152.1