Summary
Transcript IDgene_000000517
Gene IDTTHERM_00770740TTHERM_00770750
Length1135 bp
Sequence
AAATTTCTAATTTAGAAGTAAAAAAACTAGAAGAAATAAAGAATAGCAAAATCTATTTATTCAAATAATAGTATATTTTGAAAAAATGACATAGCGCGGTGATTTAAAATAATATTTTGACGAAAAAGAAGTTTAAAGTGAGCTTTAGGGAATCATTTCCCAAATTTAGAATCTTTAACCAGAAGCACAGGAAATTATTACAACCTATTGCATTTAGTGGTTCTAATCATTCTTCGACTCCCAATGTGAAGTAGAAGACTTTTTGGGTGAAATCAAAAAGCTAGAAGAACCTGAATGTGAATAAAAGTTGTTGGAATTTATCAAAAAGAAAATATCTCAAATGGAAAGCAAGTCTAAGAAAGCAAAAGAGGAGAGTAATACTTCTGCTAAGGCTTCAACCATCCATGACAGAATTAAACCAAAGGGTAACAGCAACAATGCTAATTCTGGTGCTAAAAATTAAGAAAATCCTCAAACAAACTAACCTACTACAAAGAAATTTGTAAAAATATTAGAAAAAGACGAATAAAAGCTAAAAAAAGCAAATGAAGCTGTTGAAAATAAAAACAATGCAAATAACAACTAAAATAATAACTCATCCAATGCTAATAACTAAGAAGAAAGTGATGAATATTTAATTAAAGAACTAGAAGACAAGAAGAAACAAAGATGTAAATATTATCCCAATTGTAAAAATGAAAAAACTTGCCCATACATTCATCCAACTGAACCTTGCACTTTCTTCCCTACTTGTAAGTATGGTTCTCAGTGTATAAATAAGCATCCTGATTGCAAATATGGTAAATCATGCCAAAGACCTGATTGTTTCTACGAGCACCCTTTCCCAAAAAAGCAAGCCATAAATCCTTTCCTATAAATGTTAATGATGCCTATGATGAATGCCTCTAAGAGAAAGATTACTAATAAGCCAAACGGTAAAAGACCTTTCCCTGGAAACACCCCAGGATAATTACAAGGTGGTGAAGATTAAAAATCTGAAGATAAGCAATAATAACCTTGAAAAAGATCGTTGGTTTCAATAAAATAGAAATATAATTAGAATAAAAAATTAATTAATTAATTAATCAATCAATTACAATCCCAGTATATTAATTAATACAAGTCTCAATATAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-110,744.0 L-210,073.9 L-36,419.5 S-01,299.2 S-31,489.9
S-62,199.5 S-92,400.8 S-122,648.7 S-153,006.9 S-242,945.8
C-03,447.2 C-22,533.9 C-412,001.5 C-68,074.1 C-83,904.8
C-104,425.8 C-123,978.6 C-145,463.3 C-164,026.6 C-183,210.2