Summary
Transcript IDgene_000000541
Gene IDTTHERM_00777060
Length2437 bp
Sequence
GTAAAATTGTATCAAAATACTGAATGAGTTACTAACAAGAAAATTTTCATTTGGTCAGAGGTAAGCTTTTGGCAGTTATGACTGTATAATTTGCAGAGAGCTAGAGCGAAGATATAGAAATATATTAAAATGATGATCCCAGGAAGCTCGCAGAAGAATTTATTCAAAAGAACCAATTTGATGAATCTATTTTAGAAATTATTGTTGAGAATATCAATATTAATAAAAATTTAGCTATGGAGGAATATAACAAAAACCCAGATAACTTTAAAGTATAAAAGGATTCAGATTTCAACAACTGCGATTAAGGCGAAGAACATCAGGCTTAATAAAAACCTAATGAAAAATAGAATGATGCCATTAAAAATATATAAAATGATAGTTTTATTTAGTAAAAACTAATCAATCAGCAAAATAATTATAATATTTAAAATAAAGAAAACTCAGATGATTCTCACAATCATTTCATAGAATCCTTTCAAAATTAAGAAGACTTCAAGGGCGTTAATAATTTATAATAAAAAGAGGATGATGATTATTAAGCATATCAATATAATTTAATGATGACTTAAAAAGCTGAATAGTTTTTATAGTAGAAGAATAGTTTTTAATGGTAGTAAAATGATTTTAAGAAGTAGAAAAGCGATTTTTAGTCGTAGAAGAACTAAGACTTTCAATAAAATAACCAAGTAAGAGTAATTGATAACAATGACTTCTCTAGCTCTCCAGCAAACAAATTACAGCTTATTAGAAATTAATTTAAAAAGAATAAAGTTTCAGATAAAAACCAAAGTACAAGTTAATCTCCAAATACTTCTTTTTAGAAGTAAAAGATGCAGAGTGATAGAGCGTTATTTGAATAAAGCTAGAAAGAAAATACTGCTAAGACATGCTTTAGTTAGAAAGATGATATTTATAACTCACCCTAAATAATAGATGCTAATTTAACTTCAAAGAAAAAGCTTATGACATAATCCAGTCGCTCTAAGTCGCCTAATTATCTTGCTTCAAGTTTAAGCACAAGTGCTTCAATTAAAAATAAAGATGTTGGATATATTGAAAAGATTATTTAAAAAAACTATTAAAATTAATTTTAAAATATCTTTGAATAAAGCAACAATTATAACACAAAATCTACCAGCACTTATAGAATTCTTCATAATACAGAAAATGACCCTAAACCGTTTTAGCCTTAAATTAGTAAAAGAAGCTAATAAATTGCCATGGAAAAGAATAAAGATACATCTCCAGCATTTATAAGACTACATAATTAAAAAATTAAAACTTTCATAATACAAGCAGAGCCTCCTTAAAATGAAAATTTTGAGCAGACAAAACAAAATTTGAACAAAGAAAAAGCTTCAGATAAATCAAACACAACATCTAAAAAGCTAAGCTAATTAGAAATTATGGAAATGAGCGAAAGAATGCACTTATAAGCAAAAAGGCATGAAGACAAACTTAAATAATTAAAGCTATTTTATGAAAAAATGGAAAAAGAGTAGCTGCAATAAGATTTTGGAAAGCTTTACATTGCAAAGAAATCTAAATCACCTTAAAAAAAATCTCATGGAATCATCCAAAAAGAAAAATAAAGTTAAAAAGAAGATAAAAGAACAGCAGATTGGAATTAAATGAAATAAAATGAAAATAATATTTAGCAATTCTACTATAAATCCAGAACACCTGAAAGATTAAAAATTCAATAAAATTTAAATGTTAGGAAAAGCTCTTAAAGTCCTATTCCTTCTAACAAATCAAAAACATAAATATTAACTCCTAAGCAACAAAATAAAATATGTTACAGTCCTAACAAAACAAAATAAAATAATACCTACTAACCTTAGTAGATGTAGATGCTATTAAGTAGTGATAATTTTTACAATAGTAGAAGTCCAAATAAAAATTAAGGCAAAGGGCATGAACACCTAGCTTATAGAAGTGATGATTAAGTTAAGATGTCACACATGACAATCCATACCTTGAAAATAGATAGCCTGAGAAAACAAAAGAGGATAAACGATATTTTTACTGTGCTAGACTCTGATGCAGATGGATTTATTTCATCTAATAAAATTAACGTAACTGCTCTTCCTCCTCCTCTTCTTAAAATAATATCTCCCATTCTATATGAAATGGAGGAATATAATTTCAATCTCAGCTACGAGGACTTTATTGGCTCAATTTAGCTGCTAGAAAAAACATTAAGTGATAAATAACTTGAAATACTTTATTATTAAACTGATGATTCAACCAAATATAAATTCTACAAATAAAAGCAACTAACAAACATAAGTAATTTATCTTATGAATAATTGCAAAAAATTGGAAGGTAAATAGAGTCATGCAAAGGTAATATCCATTTCAAAAACTGATATTAAATTATTTATAATTAAAAATGTAAAACTAAAATAAAAATATTTATTGACTAACAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1217.0 L-2216.3 L-3210.9 S-090.6 S-3107.5
S-6113.5 S-9133.4 S-12118.6 S-15102.1 S-24120.1
C-066.3 C-2172.5 C-43,274.8 C-62,354.2 C-81,443.3
C-10354.7 C-12455.7 C-14633.1 C-16484.1 C-18237.3