Summary
Transcript IDgene_000000711
Gene IDTTHERM_00185310
Length1042 bp
Sequence
GTTATTTTTAAAGATTGAAAACAAACATATTAAATTCATTAATTCGTTTATGAGTAGTTATATAAATCGCGGCCCTAAGGATAATTTTAATAAACAAGATTATAGAAAAGAAATAGAAGATGAGCTGAAATATAAGAGTAGTCTTTCATAGTATTAGAAAGATATTTATGAAAAAGAACAGTACATCAAAGAACTTGAAGGTCACTGCAAAGATTTAAAAACATTACTTAGTGAATATAAAAAGATGGGAGATGATAAAGAATACTAAAAAAAGCAGAGAGAAATTGAAATTGAAAATTTGAATATGAGAGTTTTGTAACTAGAAAACAAGCTTAAATTGTATGAAGATAACGAGCTGGCCAAACAAAGAATTATTGATTCAGAAGTTGAAAAAGAAAAATTAAAGAACTAGGAGATCGTTGATAGGTTTAATTAAAAATTTACTTTCTTTGAAGAATAAATATAGATCTTGGAGGGCTAACTCCTTGAAAAGAACAGATACATTTTGGAACTTGAGACTCAGAATAAAGACTTAAATTTCTTTAATTAACTTGTAGAAGAAAAACAAACACTGATTGAATCACTCAGAAGAGAAAACCAAGTCTTAATTAGAAGGATTCGTGAACAGTTCAGAGATGAAGCTTTTGGAAAAGAAAAGTTTGATTTTGAAGAAGAGAGGAAATTTATTTAAGAAATCATCAAAAAGAAAGAGTAACAAGGACTCTTTGTAGATGGCTTTGTTTCCAATCACAGAAAAGACAGTCAAATCTCTGAAAGTGTAAGGTAATAGCAAAATGTTGAGTAAAATAAAAGATACAGAAATGAACAAATATAGCAACTCTCTAATTACAATAACGTAACAGAAGAACAGAAACTTGCTAGTGAAAATCGTGCTGATTCAATAATTGACAGATATGAAGCAAATTAGACATAAAAAAAACTTTCATAGCAATATCCTTAACCTTCAGAAGCCGAAAAAGAGGAGATTAGAAAACACTAGGAAAGACTAGAGAAGTTAAAATTAAAATATAGATAAAGTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,658.1 L-22,826.9 L-33,324.3 S-03,449.5 S-31,299.3
S-61,665.5 S-9986.9 S-12746.2 S-15837.3 S-24861.0
C-0266.4 C-2273.6 C-4432.3 C-6669.3 C-8229.0
C-10244.6 C-12405.4 C-14493.6 C-16405.2 C-18266.1