Summary
Transcript IDgene_000000809
Gene IDTTHERM_00846910
Length931 bp
Sequence
AAAAAAGCAAAAGATATTATCCAATCAATTTATTATAGAATAAATAAAATGTATAGCAAAAGCGTAGTTTAGACTGCATAAAAAAAATCCATTATAGACATATTTAAATCTGAGGATAAAGATTTAAGTAAGAAAAAGTAATTAGAACAAGTAGTCTAAGGAGAAATTTGGGTAGTAAAAAAGTTTTTATCTACTAAATAATGTTAAGAAGTAATTAAATTCTCAGAAAGCTAAGGTTTTTAAGATGCTTTGGTTAATGTTGGATATGGTTTAGGAGTTCTTGATAAAGATTTTAGAGACTGCAATCGCGTTATGATTGACGATGTTGAAACTGCCTAGTATTTGGCAGAAAAACTAAGACCATATGTTCCATTATGTTAAGAAGGAGCATTATACCATGGAATGAATGAGAGATTCAGGATACTAAAGTATAGCAAAGATCAAAAGTTTGCTATGCATTAAGATGGATGTTGGAGTCCTTCGAAATCTATCTTTTCTATTTTGACAATTTAATTTTATTTGAATACAGTGGATAATGGAGGATTTACTCGCTTTGAATGGGAAGGATGGGAATCTAATGAGTATAAATGTAAATCAGAGGAGGGAAAAATAGTTATATTTAGATAGCAAGGATGGTGGCATGAAGGATCTCATGTTTTAAAAGGACTAAAATATACAGTGAGAAACGATTTAATGTTCAAATTATATACTTAGAAAGAGTGGGAACAATAAAAATAACTTCATGATCTAACTTGCGGTGTTTGCTCTAAAAAAGTTAAAGCTGAGGTGTTACAGTGTGGACATTTATTCTTATTTTGTGGTTGCCATGCATTCTATAATGGAGATATTCATACAAACCCTGAAGAAAAAAAACGTCTAAGAAGTTGCTGCTAATGTGTCAAAAAAATATAATCTCCAAGCAAAGAACTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1340.8 L-2442.9 L-3611.3 S-02,660.5 S-32,019.4
S-63,044.6 S-93,099.9 S-123,140.2 S-153,326.0 S-242,384.4
C-0205.0 C-2126.6 C-4152.0 C-695.9 C-893.9
C-1099.1 C-1275.4 C-14239.2 C-16619.8 C-18864.3